Rfam family RF00168 maps to these 16 chains: 3D0U|1|A, 3D0X|1|A, 3DIG|1|X, 3DIL|1|A, 3DIM|1|A, 3DIO|1|X, 3DIQ|1|A, 3DIR|1|A, 3DIS|1|A, 3DIX|1|A, 3DIY|1|A, 3DIZ|1|A, 3DJ0|1|A, 3DJ2|1|A, 4ERJ|1|A, 4ERL|1|A See more about them at RNA 3D Hub by filtering on the chain or the Rfam family.

Loop 13 Internal loop

Column numbers: 185-187, 197-250 - View nucleotides in PDB file(s)
    Scored sequences and counts
A-U*U----------------------------------------------------U 3
G-A*GGGGCAAUCA-------------------------------------------G 1
G-G*C----------------------------------------------------C 1
Omitted sequenced and counts
--U*-----------------------------------------------------A 7
--A*------------------------------------------------------ 4
--A*GUCGGGCGUUUCGC---------------------------------------A 3
--U*-----------------------------------------------------U 3
--U*------------------------------------------------------ 3
--A*-----------------------------------------------------U 2
--C*------------------------------------------------------ 2
--G*------------------------------------------------------ 2
--A*GUCGGGCGUUUCAUACCCGAACACCUCAGCGCCCAAAGCGGUGAGUCGGGUCUA 1
--G*UAGGGCGGUCA------------------------------------------A 1
--U*UGGACGUCCA-------------------------------------------G 1
--G*GC---------------------------------------------------C 1
--U*UU---------------------------------------------------A 1
CGG*-----------------------------------------------------G 1
GGU*-----------------------------------------------------A 1
A-A*-----------------------------------------------------C 1
A-G*-----------------------------------------------------U 1
G-G*-----------------------------------------------------A 1
--A*-----------------------------------------------------A 1
--C*-----------------------------------------------------G 1
--G*-----------------------------------------------------C 1
--U*-----------------------------------------------------C 1
A-A*------------------------------------------------------ 1
G-U*------------------------------------------------------ 1
Click on headings to reorder table
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 80.00 -1667.82 2 1

Major groove platform

2 20.00 -137.89 3 1

Major groove intercalation

3 20.00 -2138.98 3 2

Multiple bulged bases

4 20.00 -2141.92 4 1

5 20.00 -2149.33 4 1

Intercalated cWS

6 20.00 -2156.52 3 1

Multiple bulged bases

7 20.00 -2158.79 4 1

8 20.00 -2161.85 5 1

9 20.00 -2162.03 2 1

Single bulged G

10 20.00 -2164.24 2 1

Single stack bend

11 20.00 -2166.32 2 1

Single stack bend

12 20.00 -2173.87 4 1

Stack and bulge

13 20.00 -2179.97 2 1

Single bulged C

14 20.00 -2189.74 2 1

Single bulged A

15 20.00 -2200.90 1 1

Single bulged U

16 0.00 -160.65 8 6

17 0.00 -167.42 6 4

18 0.00 -179.67 6 4

19 0.00 -179.91 7 6

20 0.00 -188.63 6 4

21 0.00 -190.32 9 7

22 0.00 -191.38 5 3

Multiple bulged bases

23 0.00 -192.37 7 5

24 0.00 -192.43 8 7

25 0.00 -192.59 6 2

26 0.00 -195.84 6 5

27 0.00 -196.20 6 5

28 0.00 -196.85 10 7

29 0.00 -198.03 10 7

Vitamin B12 Aptamer

30 0.00 -199.61 9 8

31 0.00 -200.64 9 6

32 0.00 -201.51 10 7

33 0.00 -202.64 6 5

34 0.00 -205.72 4 4

35 0.00 -206.38 8 5

36 0.00 -206.42 8 5

37 0.00 -206.47 12 9

38 0.00 -206.88 3 2

39 0.00 -207.47 11 7

40 0.00 -207.62 12 9

41 0.00 -207.71 9 5

42 0.00 -209.17 10 8

43 0.00 -210.63 3 2

44 0.00 -211.41 9 8

Reverse kink-turn related

45 0.00 -212.58 4 2

46 0.00 -212.73 5 3

Bulged stacked bases

47 0.00 -213.30 10 8

48 0.00 -214.11 8 7

49 0.00 -214.94 6 2

50 0.00 -215.03 7 6

Intercalated tWH

51 0.00 -216.06 4 3

52 0.00 -216.57 7 6

Pseudoknot

53 0.00 -217.82 10 6

54 0.00 -218.12 8 6

55 0.00 -218.83 9 8

56 0.00 -219.71 10 7

tSH-tHW

57 0.00 -221.66 8 7

58 0.00 -222.57 8 6

59 0.00 -222.69 4 2

60 0.00 -223.12 10 7

61 0.00 -223.12 10 8

62 0.00 -225.23 9 6

63 0.00 -225.49 7 5

64 0.00 -226.04 7 6

65 0.00 -226.37 7 6

66 0.00 -228.90 8 5

67 0.00 -229.82 12 9

68 0.00 -230.56 8 6

69 0.00 -232.59 8 6

70 0.00 -233.75 7 7

71 0.00 -234.33 8 7

Minor groove platform

72 0.00 -234.46 5 3

73 0.00 -235.24 9 7

74 0.00 -236.74 7 6

75 0.00 -237.28 10 8

76 0.00 -237.67 6 4

77 0.00 -237.93 9 7

78 0.00 -238.00 9 8

79 0.00 -238.33 7 5

Major groove intercalation

80 0.00 -238.76 8 6

81 0.00 -239.30 10 7

82 0.00 -242.18 5 4

83 0.00 -242.33 9 6

84 0.00 -243.94 6 4

85 0.00 -245.29 11 8

86 0.00 -245.61 11 9

87 0.00 -245.87 8 7

88 0.00 -246.90 7 5

89 0.00 -248.37 12 8

90 0.00 -248.88 6 6

91 0.00 -249.71 10 8

92 0.00 -249.72 7 5

93 0.00 -250.41 10 8

94 0.00 -250.93 10 8

95 0.00 -251.81 9 9

Reverse turn

96 0.00 -252.06 8 5

97 0.00 -252.73 6 5

98 0.00 -252.76 11 9

99 0.00 -253.23 12 10

100 0.00 -255.54 10 8

Kink-turn

101 0.00 -255.76 7 7

102 0.00 -255.83 8 7

103 0.00 -256.01 7 4

104 0.00 -256.55 8 5

Decoding loop related

105 0.00 -257.10 4 3

106 0.00 -257.48 6 3

Left turn

107 0.00 -260.27 4 4

108 0.00 -261.44 10 7

Reverse kink-turn

109 0.00 -261.53 8 8

110 0.00 -262.08 13 9

111 0.00 -263.06 9 7

112 0.00 -265.12 9 5

113 0.00 -266.65 4 3

114 0.00 -267.05 11 10

115 0.00 -268.19 6 6

180 degree turn

116 0.00 -268.78 10 7

Kink-turn related

117 0.00 -269.49 8 7

118 0.00 -269.74 11 8

119 0.00 -270.14 7 6

120 0.00 -270.76 6 5

Isolated non-canonical cWW pair

121 0.00 -271.42 9 7

UAA/GAN related

122 0.00 -272.39 10 9

123 0.00 -273.43 10 8

124 0.00 -274.75 8 7

125 0.00 -276.00 6 6

126 0.00 -277.37 10 9

Kink-turn

127 0.00 -278.78 8 7

cWH basepair with bulged bases

128 0.00 -278.79 4 3

129 0.00 -278.87 11 9

130 0.00 -279.06 11 9

131 0.00 -279.15 11 9

132 0.00 -279.45 12 10

133 0.00 -280.87 11 9

134 0.00 -281.92 11 10

135 0.00 -281.98 8 6

136 0.00 -283.18 11 10

137 0.00 -285.74 9 5

138 0.00 -287.52 9 7

139 0.00 -287.97 10 10

140 0.00 -288.09 8 6

tSH-tHW

141 0.00 -288.41 13 11

Pseudoknot

142 0.00 -288.55 8 6

143 0.00 -288.97 10 9

tHW-tHW cross-strand stack

144 0.00 -289.30 14 11

145 0.00 -290.92 10 8

146 0.00 -291.36 8 5

147 0.00 -292.88 13 12

148 0.00 -294.80 13 12

149 0.00 -294.87 8 7

150 0.00 -295.51 10 10

151 0.00 -296.09 9 9

152 0.00 -298.57 9 8

Kink-turn with embedded cWW pair

153 0.00 -299.68 9 7

Kink-turn from U4

154 0.00 -300.11 11 11

155 0.00 -301.46 10 9

156 0.00 -301.57 10 9

Sarcin-Ricin target in LSU H95; G-bulge

157 0.00 -301.63 11 10

158 0.00 -301.82 13 12

159 0.00 -303.85 9 8

160 0.00 -303.90 6 4

161 0.00 -305.75 15 14

162 0.00 -310.22 8 5

163 0.00 -310.41 13 12

164 0.00 -310.97 12 11

165 0.00 -312.73 11 10

8x6 Sarcin-Ricin with inserted A; G-bulge

166 0.00 -314.25 12 9

167 0.00 -314.40 3 3

168 0.00 -315.35 6 4

169 0.00 -315.44 7 6

AAA cross-strand stack

170 0.00 -315.80 10 8

171 0.00 -316.27 9 9

Part of G-quadruplex

172 0.00 -318.33 5 3

Decoding loop related

173 0.00 -318.65 4 4

174 0.00 -321.01 8 6

SSU/LSU pseudoknot

175 0.00 -321.41 11 10

176 0.00 -322.38 5 2

Major groove platform with intercalated tWH

177 0.00 -322.96 11 10

178 0.00 -326.72 5 4

179 0.00 -327.09 17 16

Kink-turn related

180 0.00 -330.46 12 10

tSH-tHS-tHW

181 0.00 -334.60 13 12

182 0.00 -335.13 13 12

183 0.00 -338.11 11 10

184 0.00 -338.21 12 11

185 0.00 -338.37 12 11

186 0.00 -341.64 19 16

187 0.00 -342.01 7 5

188 0.00 -342.19 12 10

189 0.00 -343.30 13 11

190 0.00 -345.01 17 16

191 0.00 -348.84 13 12

192 0.00 -348.84 10 9

Kink-turn

193 0.00 -351.70 10 7

194 0.00 -352.95 13 12

195 0.00 -354.31 10 10

7x7 Sarcin-Ricin with intercalated A; G-bulge

196 0.00 -355.42 17 15

Pseudoknot

197 0.00 -357.20 12 12

198 0.00 -360.13 8 5

Major groove intercalation

199 0.00 -362.10 11 10

8x6 Sarcin-Ricin with inserted Y; G-bulge

200 0.00 -363.01 11 11

201 0.00 -369.18 14 13

202 0.00 -373.36 11 11

Kink-turn

203 0.00 -374.65 15 15

204 0.00 -378.30 14 13

205 0.00 -379.43 9 6

206 0.00 -382.37 14 14

207 0.00 -385.68 19 18

Kink-turn

208 0.00 -388.79 14 13

209 0.00 -389.08 7 6

UAA/GAN

210 0.00 -389.89 13 13

211 0.00 -391.03 16 16

212 0.00 -393.35 6 3

Major groove minor groove platform with intercalation; mini C-loop

213 0.00 -393.43 14 13

214 0.00 -395.46 16 13

215 0.00 -397.55 18 16

216 0.00 -400.12 6 5

217 0.00 -400.96 16 13

218 0.00 -400.98 13 12

219 0.00 -401.96 15 14

10x8 Sarcin-Ricin; G-bulge

220 0.00 -405.09 14 13

221 0.00 -405.19 14 13

222 0.00 -411.21 10 10

Minor groove platform related

223 0.00 -414.64 14 13

224 0.00 -418.09 17 15

Pseudoknot

225 0.00 -421.92 19 18

226 0.00 -423.79 15 15

227 0.00 -425.65 14 13

9x8 Sarcin-Ricin with GA cWW pair; G-bulge

228 0.00 -434.07 19 19

229 0.00 -437.60 18 17

230 0.00 -437.85 20 19

231 0.00 -441.14 15 14

9x9 Sarcin-Ricin with pseudoknotted region; G-bulge

232 0.00 -443.33 15 14

7x11 Sarcin-Ricin with pseudoknotted region; G-bulge

233 0.00 -453.64 20 19

234 0.00 -482.67 14 14

235 0.00 -521.37 22 22

236 0.00 -548.24 23 22

237 0.00 -591.81 24 24

238 0.00 -609.99 25 24

239 0.00 -617.56 21 21

240 0.00 -1120.03 13 13

241 0.00 -1134.31 12 11

242 0.00 -1159.17 16 15

243 0.00 -1177.96 16 14

244 0.00 -1183.79 7 7

245 0.00 -1196.93 16 16

246 0.00 -1223.27 17 16

247 0.00 -1228.16 13 13

tSH-tHW-tHH-tHS

248 0.00 -1242.51 11 8

Other IL

249 0.00 -1243.54 10 7

Part of G-quadruplex

250 0.00 -1244.92 11 9

Reverse kink-turn related

251 0.00 -1247.10 10 8

252 0.00 -1247.32 10 9

tWH-tWH-tHW-tHW

253 0.00 -1247.54 11 9

Kink-turn related

254 0.00 -1254.42 8 8

255 0.00 -1258.29 12 10

256 0.00 -1265.19 9 9

7x6 Sarcin-Ricin with UU cWW pair; G-bulge

257 0.00 -1279.72 6 5

258 0.00 -1281.00 7 6

259 0.00 -1281.95 12 11

8x7 Sarcin-Ricin; G-bulge

260 0.00 -1287.09 12 10

261 0.00 -1293.53 9 8

262 0.00 -1293.81 9 7

263 0.00 -1294.17 12 10

8x6 Sarcin-Ricin with bulged A; G-bulge

264 0.00 -1294.72 10 10

Triple sheared with non-canonical cWW

265 0.00 -1299.91 10 9

Kink-turn

266 0.00 -1305.23 10 8

267 0.00 -1307.11 11 10

Kink-turn

268 0.00 -1309.17 7 6

269 0.00 -1312.28 13 10

270 0.00 -1313.22 21 19

Kink-turn related

271 0.00 -1316.50 11 9

Kink-turn

272 0.00 -1326.12 15 14

273 0.00 -1328.85 11 11

8x7 Sarcin-Ricin; G-bulge

274 0.00 -1330.77 6 6

Kink-turn related

275 0.00 -1331.59 11 11

276 0.00 -1333.25 13 11

8x7 Sarcin-Ricin with CC bifurcated pair; G-bulge

277 0.00 -1334.65 12 11

Kink-turn

278 0.00 -1338.99 9 9

Kink-turn

279 0.00 -1339.27 9 6

280 0.00 -1348.08 10 9

tSH-tSH-tHH-tHS

281 0.00 -1349.36 11 11

282 0.00 -1353.14 8 7

Triple sheared related

283 0.00 -1353.39 12 11

284 0.00 -1361.65 9 9

7x6 Sarcin-Ricin; G-bulge

285 0.00 -1369.97 15 14

Bacterial 5S Loop E

286 0.00 -1374.40 12 12

Kink-turn related

287 0.00 -1374.95 6 6

288 0.00 -1377.45 12 12

289 0.00 -1378.67 10 7

UAA/GAN with tHH

290 0.00 -1382.28 9 8

Double sheared; A in syn; two near cWW pairs

291 0.00 -1382.49 9 8

tSH-tWH-tHS-cWW

292 0.00 -1383.92 9 8

Kink-turn related

293 0.00 -1385.53 10 10

294 0.00 -1387.58 9 7

6x5 Sarcin-Ricin; G-bulge

295 0.00 -1392.28 9 7

UAA/GAN with extra stack

296 0.00 -1405.92 10 10

Kink-turn with non-sequential stacking

297 0.00 -1407.20 10 9

Kink-turn

298 0.00 -1408.18 9 7

299 0.00 -1410.45 11 10

Kink-turn

300 0.00 -1413.95 9 8

301 0.00 -1415.90 6 5

Receptor of 11-nt loop-receptor motif

302 0.00 -1420.88 21 21

303 0.00 -1434.35 14 14

304 0.00 -1438.31 6 5

Receptor of 11-nt loop-receptor motif

305 0.00 -1443.57 12 11

306 0.00 -1447.00 12 11

307 0.00 -1456.29 8 5

308 0.00 -1458.05 10 8

tSH-tHW-tWH-tHS

309 0.00 -1465.63 6 5

310 0.00 -1469.24 9 7

Other IL

311 0.00 -1500.24 8 6

312 0.00 -1501.44 9 7

313 0.00 -1517.44 17 16

314 0.00 -1519.52 6 6

315 0.00 -1543.63 8 8

316 0.00 -1544.30 16 14

317 0.00 -1545.23 10 7

318 0.00 -1566.46 8 8

UAA/GAN with extra cWW

319 0.00 -1588.23 9 7

tSH-tHH-tHS

320 0.00 -1604.38 6 5

321 0.00 -1656.39 9 8

Quadruple sheared

322 0.00 -1668.77 4 4

323 0.00 -1690.92 7 5

324 0.00 -1712.00 5 4

8-nt loop receptor

325 0.00 -1735.16 6 4

326 0.00 -1751.00 7 5

327 0.00 -1751.12 11 8

Kink-turn

328 0.00 -1773.91 8 6

Triple sheared

329 0.00 -1776.80 5 4

Tandem non-canonical cWW pairs

330 0.00 -1788.99 7 6

cWH basepair and non-canonical AC

331 0.00 -1797.21 6 4

332 0.00 -1816.68 5 4

333 0.00 -1826.94 8 5

334 0.00 -1849.69 6 5

335 0.00 -1856.43 6 4

336 0.00 -1865.87 4 4

337 0.00 -1882.62 7 5

UAA/GAN

338 0.00 -1885.15 8 6

Symmetric double minor groove platform

339 0.00 -1887.59 5 4

Double sheared

340 0.00 -1901.11 4 4

341 0.00 -1910.54 4 4

Other IL

342 0.00 -1916.87 6 5

343 0.00 -1951.13 6 4

344 0.00 -1971.93 7 4

345 0.00 -1979.17 7 6

Double sheared with non-canonical cWW

346 0.00 -2000.90 7 4

347 0.00 -2005.69 8 6

tSH-tWH-tHS

348 0.00 -2022.92 7 6

5x5 Sarcin-Ricin with intercalated A; G-bulge

349 0.00 -2030.75 7 4

350 0.00 -2065.40 7 3

351 0.00 -2065.89 8 4

352 0.00 -2090.94 6 5

tSH-tHW

353 0.00 -2097.43 6 4

354 0.00 -2101.40 5 4

355 0.00 -2120.08 7 4

356 0.00 -2128.19 7 4

Multiple bulged bases

357 0.00 -2136.57 6 6

Triple non-canonical cWW pairs

358 0.00 -2142.72 6 3

359 0.00 -2181.37 4 4

Tandem non-canonical cWW pairs

360 0.00 -2185.26 7 6

Triple sheared

361 0.00 -2201.18 2 2

Multiple bulged bases

362 0.00 -2213.86 4 2

363 0.00 -2215.86 3 2

364 0.00 -2217.17 2 2

Isolated non-canonical cWW pair

365 0.00 -2219.67 6 4

Minor groove platform

366 0.00 -2225.92 2 2

Isolated non-canonical cWW pair

367 0.00 -2228.34 3 2

Isolated cWS basepair

368 0.00 -2228.36 3 2

Isolated non-canonical cWW pair

369 0.00 -2232.44 6 5

370 0.00 -2235.46 2 2

Isolated non-canonical cWW pair

371 0.00 -2239.05 3 2

Isolated non-canonical cWW contact

372 0.00 -2240.86 4 2

Isolated tWW turn

373 0.00 -2246.48 3 2

Isolated cWH basepair

374 0.00 -2246.84 5 2

375 0.00 -2255.38 4 2

Isolated tHS basepair with bulges

376 0.00 -2257.71 4 2

Isolated non-canonical cWW pair

377 0.00 -2276.14 5 1

378 0.00 -2276.73 4 3

379 0.00 -2283.06 6 3

380 0.00 -2292.38 3 1

Major groove platform

381 0.00 -2294.83 4 1

382 0.00 -2294.92 4 2

383 0.00 -2295.33 5 3

384 0.00 -2305.32 4 3

385 0.00 -2309.42 5 3

386 0.00 -2312.50 6 4

387 0.00 -2322.34 2 1

Minor groove platform

388 0.00 -2341.97 6 3

389 0.00 -2344.31 7 5

390 0.00 -2363.59 5 4

391 0.00 -2365.95 8 5

UAA/GAN related

392 0.00 -2371.00 4 4

Tandem non-canonical cWW pairs

393 0.00 -2380.04 6 4

394 0.00 -2385.95 5 4

395 0.00 -2386.00 5 4

Double sheared

396 0.00 -2389.78 4 2

Minor groove platform, major groove intercalation

397 0.00 -2399.05 4 2

Major groove platform with intercalation

398 0.00 -2408.27 3 2

Minor groove platform

399 0.00 -2412.28 5 3

Minor groove platform

400 0.00 -2413.52 2 2

Major groove minor groove platform; mini C-loop

401 0.00 -2436.70 3 2

Major groove platform; stack outside cWW

402 0.00 -2448.91 6 5

UAA/GAN variation

403 0.00 -6258.36 10 9

404 0.00 -7020.53 7 5

C-loop with bulged stacked A's

405 0.00 -8856.12 4 4

C-loop

406 0.00 -9999.00 4 3

C-loop

407 0.00 -9999.00 21 21

408 0.00 -9999.00 18 18

409 0.00 -9999.00 23 23

410 0.00 -9999.00 4 2

411 0.00 -9999.00 6 4

Coloring options: