Rfam family RF03072 maps to these 6 chains: 9CXF|1|A, 9E73|1|A, 9E74|1|A, 9E75|1|A, 9ELY|1|A, 9G7C|1|A See more about them at RNA 3D Hub by filtering on the chain or the Rfam family.

Loop 1 Internal loop

Column numbers: 119-120, 302-339 - View nucleotides in PDB file(s)
    Scored sequences and counts
AG*C------------------------------------U 219
AG*C------------------------------------C 116
AG*U------------------------------------U 101
AG*U------------------------------------C 21
AG*U------------------------------------A 19
AG*U------------------------------------G 3
AG*U-----------------------------------CU 2
AG*U-----------------------------------UU 2
AG*CCGGCCUGGGCUGCCGAAGCUCAGCAGCUCUGAAGUCC 1
AU*G-CCGGGGAAGCGAAGAGCUUCCAAG-----------A 1
AG*A------------------------------------C 1
Omitted sequenced and counts
AG*C------------------------------------- 2
Click on headings to reorder table
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 89.71 -28.37 3 2

Multiple bulged bases

2 75.51 -19.90 2 1

Major groove platform

3 66.67 -38.80 4 1

Intercalated cWS

4 66.67 -41.62 2 1

Major groove intercalation

5 66.67 -44.64 3 1

6 66.67 -47.11 2 1

Single bulged G

7 66.26 -36.87 2 1

Multiple bulged bases

8 45.88 -39.96 3 1

9 45.88 -45.76 1 1

Single stack bend

10 45.88 -49.33 3 1

11 45.47 -56.37 2 1

Single bulged C

12 45.06 -49.65 1 1

Single stack bend

13 45.06 -54.60 2 1

Stack and bulge

14 45.06 -58.95 2 1

Single bulged A

15 45.06 -60.81 2 1

Single bulged U

16 0.82 -109.18 3 2

Multiple bulged bases

17 0.82 -120.40 4 2

18 0.82 -158.29 3 1

19 0.82 -175.54 1 1

Minor groove platform

20 0.82 -218.17 2 1

Major groove platform

21 0.41 -106.97 3 2

22 0.00 -113.85 2 2

Isolated tWW turn

23 0.00 -114.68 4 2

24 0.00 -116.49 4 2

25 0.00 -118.99 3 2

Isolated cWS basepair

26 0.00 -121.26 3 2

Isolated non-canonical cWW pair

27 0.00 -122.15 2 2

Isolated non-canonical cWW pair

28 0.00 -123.66 4 2

Isolated non-canonical cWW pair

29 0.00 -126.83 4 2

Isolated non-canonical cWW contact

30 0.00 -126.89 4 2

31 0.00 -127.04 4 2

32 0.00 -127.60 4 2

33 0.00 -130.51 2 2

Isolated non-canonical cWW pair

34 0.00 -131.87 3 2

35 0.00 -136.30 3 2

Isolated tHS basepair with bulges

36 0.00 -138.48 2 2

Isolated cWH basepair

37 0.00 -139.78 4 2

38 0.00 -140.44 5 4

39 0.00 -141.13 5 3

Multiple bulged bases

40 0.00 -141.70 3 2

Isolated non-canonical cWW pair

41 0.00 -156.23 6 4

42 0.00 -157.36 7 6

43 0.00 -158.70 6 4

44 0.00 -158.96 7 5

45 0.00 -160.20 4 3

Bulged stacked bases

46 0.00 -170.68 6 4

47 0.00 -170.81 5 5

48 0.00 -173.44 5 3

49 0.00 -175.11 3 3

50 0.00 -176.75 6 4

51 0.00 -177.04 6 5

52 0.00 -178.59 6 3

53 0.00 -178.66 4 3

54 0.00 -179.39 6 5

55 0.00 -180.53 7 5

56 0.00 -181.39 6 5

57 0.00 -182.09 6 5

58 0.00 -182.16 4 3

59 0.00 -183.55 7 4

60 0.00 -186.33 5 5

Receptor of 11-nt loop-receptor motif

61 0.00 -187.74 7 4

62 0.00 -188.00 6 6

63 0.00 -188.64 6 5

Receptor of 11-nt loop-receptor motif

64 0.00 -189.42 7 5

65 0.00 -190.50 6 3

66 0.00 -190.92 7 6

Pseudoknot

67 0.00 -191.32 7 6

68 0.00 -194.64 7 6

69 0.00 -194.77 7 7

70 0.00 -197.03 5 3

71 0.00 -197.77 5 5

72 0.00 -198.29 5 3

73 0.00 -200.03 7 6

Kink-turn related

74 0.00 -200.18 5 4

75 0.00 -200.53 9 7

76 0.00 -200.76 5 4

77 0.00 -201.21 6 6

Intercalated tWH

78 0.00 -202.15 7 6

79 0.00 -203.07 5 4

80 0.00 -203.61 2 1

81 0.00 -203.99 7 6

82 0.00 -204.47 7 7

83 0.00 -205.26 8 5

84 0.00 -205.30 7 5

85 0.00 -205.64 7 7

86 0.00 -206.97 5 4

Tandem non-canonical cWW pairs

87 0.00 -207.10 9 7

88 0.00 -207.55 8 6

89 0.00 -207.57 6 6

90 0.00 -208.71 5 3

91 0.00 -209.15 6 4

Double sheared

92 0.00 -210.43 4 3

93 0.00 -210.48 4 3

94 0.00 -210.79 6 6

95 0.00 -212.47 8 7

96 0.00 -212.51 4 3

97 0.00 -212.76 7 5

98 0.00 -213.17 8 5

99 0.00 -213.38 4 4

100 0.00 -214.54 9 7

tSH-tHW

101 0.00 -214.76 8 6

102 0.00 -215.26 7 6

103 0.00 -215.49 7 7

Part of G-quadruplex

104 0.00 -215.99 5 5

Decoding loop related

105 0.00 -216.33 8 7

Vitamin B12 Aptamer

106 0.00 -216.75 4 3

Left turn

107 0.00 -216.99 4 4

Other IL

108 0.00 -217.04 4 3

Decoding loop related

109 0.00 -219.26 7 7

110 0.00 -219.27 6 6

111 0.00 -219.53 7 6

112 0.00 -221.03 7 6

113 0.00 -221.18 5 4

114 0.00 -221.30 4 4

115 0.00 -222.61 7 5

116 0.00 -223.23 4 3

117 0.00 -224.06 7 6

118 0.00 -225.01 6 4

119 0.00 -225.30 7 7

120 0.00 -225.52 8 8

121 0.00 -226.35 9 8

122 0.00 -226.80 7 6

123 0.00 -227.41 5 3

124 0.00 -227.49 8 6

125 0.00 -227.50 9 8

126 0.00 -227.94 8 6

127 0.00 -228.21 7 5

128 0.00 -228.92 8 7

129 0.00 -229.10 10 7

130 0.00 -229.95 7 5

131 0.00 -230.09 6 4

132 0.00 -230.94 5 4

133 0.00 -231.07 6 4

134 0.00 -232.12 5 4

Multiple bulged bases

135 0.00 -232.60 6 6

136 0.00 -233.00 7 7

137 0.00 -233.40 6 4

138 0.00 -233.69 10 8

139 0.00 -234.02 8 7

Triple sheared related

140 0.00 -234.77 7 5

141 0.00 -236.42 8 7

142 0.00 -238.71 2 2

143 0.00 -239.19 6 4

144 0.00 -239.91 7 5

145 0.00 -240.73 8 8

Reverse kink-turn related

146 0.00 -241.45 7 6

147 0.00 -241.50 9 8

148 0.00 -241.60 9 7

149 0.00 -241.60 5 4

150 0.00 -241.76 9 7

UAA/GAN with extra stack

151 0.00 -243.53 9 8

152 0.00 -243.89 7 6

tSH-tHW

153 0.00 -244.43 9 8

154 0.00 -244.44 6 5

155 0.00 -244.54 5 5

156 0.00 -244.66 6 5

Major groove intercalation

157 0.00 -244.72 9 7

158 0.00 -244.99 8 7

UAA/GAN with tHH

159 0.00 -246.43 10 8

Other IL

160 0.00 -246.96 8 6

161 0.00 -247.19 7 7

6x5 Sarcin-Ricin; G-bulge

162 0.00 -248.19 8 7

Reverse kink-turn

163 0.00 -248.27 7 7

164 0.00 -249.23 6 5

Isolated non-canonical cWW pair

165 0.00 -249.63 11 9

166 0.00 -249.85 10 8

167 0.00 -250.39 9 8

168 0.00 -250.50 5 4

169 0.00 -250.84 11 9

170 0.00 -251.07 9 8

171 0.00 -251.33 9 9

Reverse turn

172 0.00 -252.35 5 5

173 0.00 -253.02 7 7

Other IL

174 0.00 -253.77 8 8

175 0.00 -254.02 9 8

176 0.00 -254.28 6 6

180 degree turn

177 0.00 -254.94 9 7

178 0.00 -255.26 8 5

179 0.00 -256.76 4 2

Major groove platform with intercalated tWH

180 0.00 -256.95 9 8

181 0.00 -257.04 9 8

Kink-turn

182 0.00 -257.36 9 8

183 0.00 -257.53 7 6

184 0.00 -258.02 7 7

185 0.00 -258.39 6 6

186 0.00 -258.72 4 4

Tandem non-canonical cWW pairs

187 0.00 -258.84 3 2

Minor groove platform, major groove intercalation

188 0.00 -258.85 6 4

189 0.00 -261.65 8 8

190 0.00 -261.94 7 7

191 0.00 -262.59 6 5

192 0.00 -263.72 8 7

UAA/GAN related

193 0.00 -263.87 6 6

AAA cross-strand stack

194 0.00 -264.77 4 4

195 0.00 -265.26 10 9

Kink-turn related

196 0.00 -265.48 8 7

Kink-turn from U4

197 0.00 -267.85 10 9

198 0.00 -267.96 11 9

199 0.00 -269.41 9 9

200 0.00 -271.44 5 4

201 0.00 -271.86 8 6

cWH basepair and non-canonical AC

202 0.00 -272.47 8 7

tSH-tHH-tHS

203 0.00 -272.55 8 7

204 0.00 -272.61 11 9

205 0.00 -273.04 11 9

tWH-tWH-tHW-tHW

206 0.00 -273.75 10 9

207 0.00 -274.48 9 9

208 0.00 -274.74 8 8

Double sheared; A in syn; two near cWW pairs

209 0.00 -275.33 8 8

Kink-turn with embedded cWW pair

210 0.00 -276.10 4 4

Tandem non-canonical cWW pairs

211 0.00 -277.38 8 8

tSH-tWH-tHS-cWW

212 0.00 -278.33 5 4

213 0.00 -279.46 6 5

UAA/GAN

214 0.00 -279.55 9 9

tHW-tHW cross-strand stack

215 0.00 -279.75 9 9

Kink-turn

216 0.00 -280.34 8.5 8

217 0.00 -281.16 9 9

Reverse kink-turn related

218 0.00 -281.46 10 10

219 0.00 -281.90 11 10

220 0.00 -282.20 10 8

221 0.00 -282.33 5 4

222 0.00 -282.85 9 8

223 0.00 -282.98 9 7

Kink-turn related

224 0.00 -283.96 9 9

225 0.00 -285.45 9 7

Minor groove platform

226 0.00 -286.10 4 4

Double sheared

227 0.00 -286.24 9 9

Sarcin-Ricin target in LSU H95; G-bulge

228 0.00 -286.67 5 5

tSH-tHW

229 0.00 -287.23 8 6

Triple sheared

230 0.00 -288.07 3 2

Major groove platform with intercalation

231 0.00 -289.66 4 4

232 0.00 -289.67 11 9

7x6 Sarcin-Ricin with UU cWW pair; G-bulge

233 0.00 -290.03 10 8

234 0.00 -290.18 9 8

tSH-tHW-tWH-tHS

235 0.00 -290.81 10 7

236 0.00 -292.77 11 10

237 0.00 -294.29 10 9

238 0.00 -294.62 9 8

239 0.00 -295.00 5 4

240 0.00 -296.56 10 9

241 0.00 -296.98 10 8

242 0.00 -297.38 11 10

243 0.00 -298.64 10 7

cWH basepair with bulged bases

244 0.00 -298.82 10 10

245 0.00 -299.72 10 9

246 0.00 -299.98 9 7

247 0.00 -301.31 9 9

tSH-tSH-tHH-tHS

248 0.00 -302.72 11 9

Kink-turn

249 0.00 -303.12 10 9

250 0.00 -303.65 9 9

7x6 Sarcin-Ricin; G-bulge

251 0.00 -304.58 12 10

252 0.00 -305.69 10 10

253 0.00 -306.50 10 10

254 0.00 -307.15 10 10

8x6 Sarcin-Ricin with inserted A; G-bulge

255 0.00 -307.41 8 7

256 0.00 -308.22 6 5

257 0.00 -309.11 10 10

tSH-tHS-tHW

258 0.00 -310.04 9 7

259 0.00 -310.07 11 10

260 0.00 -310.14 12 10

261 0.00 -310.62 6 5

262 0.00 -312.74 6 5

263 0.00 -313.01 10 10

264 0.00 -313.13 8 6

265 0.00 -313.80 6 6

UAA/GAN

266 0.00 -314.40 9 9

Kink-turn

267 0.00 -314.59 10 10

268 0.00 -315.07 10 10

7x7 Sarcin-Ricin with intercalated A; G-bulge

269 0.00 -315.49 8 8

270 0.00 -316.38 13 10

271 0.00 -320.26 12 12

272 0.00 -320.39 12 11

273 0.00 -320.60 5.5 4

274 0.00 -321.03 9 7

275 0.00 -321.46 12 11

276 0.00 -322.31 10 10

Triple sheared with non-canonical cWW

277 0.00 -322.39 8 7

278 0.00 -323.05 9 9

Kink-turn

279 0.00 -324.46 8 8

UAA/GAN with extra cWW

280 0.00 -324.71 11 11

281 0.00 -324.80 11 10

282 0.00 -325.34 11 10

Kink-turn

283 0.00 -325.97 11 10

8x6 Sarcin-Ricin with inserted Y; G-bulge

284 0.00 -326.73 12 12

285 0.00 -327.46 11 10

8x6 Sarcin-Ricin with bulged A; G-bulge

286 0.00 -327.79 10 9

Kink-turn

287 0.00 -328.27 7 5

288 0.00 -330.07 7 4

8-nt loop receptor

289 0.00 -330.53 6 6

Double sheared with non-canonical cWW

290 0.00 -332.17 12 11

291 0.00 -333.09 12 11

Pseudoknot

292 0.00 -333.60 8 8

Quadruple sheared

293 0.00 -333.61 5 5

294 0.00 -334.11 5 5

295 0.00 -334.38 6 6

tSH-tWH-tHS

296 0.00 -334.77 10 10

297 0.00 -334.88 13 11

298 0.00 -335.79 14 13

299 0.00 -336.39 10 9

300 0.00 -337.24 11 11

8x7 Sarcin-Ricin; G-bulge

301 0.00 -338.68 9 8

Kink-turn related

302 0.00 -340.20 6 5

UAA/GAN related

303 0.00 -340.31 10 10

304 0.00 -340.95 7 6

5x5 Sarcin-Ricin with intercalated A; G-bulge

305 0.00 -341.12 10 9

Kink-turn

306 0.00 -342.01 8 6

307 0.00 -342.52 10 8

308 0.00 -342.65 12 10

Kink-turn

309 0.00 -346.54 11 11

310 0.00 -346.79 15 14

311 0.00 -346.99 5 4

312 0.00 -347.60 12 11

313 0.00 -352.26 12 11

Kink-turn

314 0.00 -352.55 12 12

315 0.00 -353.00 6 5

316 0.00 -353.09 9 8

317 0.00 -353.57 13 12

318 0.00 -354.52 6 5

UAA/GAN variation

319 0.00 -355.08 12 11

320 0.00 -355.11 13 12

321 0.00 -355.49 11 11

Kink-turn

322 0.00 -355.69 7 4

Minor groove platform

323 0.00 -357.07 11 11

8x7 Sarcin-Ricin; G-bulge

324 0.00 -357.68 12 12

325 0.00 -359.46 13 11

326 0.00 -359.76 11 11

8x7 Sarcin-Ricin with CC bifurcated pair; G-bulge

327 0.00 -359.77 7 6

Triple non-canonical cWW pairs

328 0.00 -363.43 7 6

SSU/LSU pseudoknot

329 0.00 -366.19 16 16

Kink-turn related

330 0.00 -368.46 15 15

331 0.00 -369.66 13 12

332 0.00 -369.73 13 13

tSH-tHW-tHH-tHS

333 0.00 -370.01 12 12

334 0.00 -370.78 13 11

335 0.00 -371.89 6 6

Triple sheared

336 0.00 -373.35 15 14

337 0.00 -375.28 2 2

Major groove platform; stack outside cWW

338 0.00 -376.22 16 16

339 0.00 -376.72 6 4

340 0.00 -380.41 4 2

Minor groove platform

341 0.00 -381.27 17 16

342 0.00 -383.26 16 15

Pseudoknot

343 0.00 -385.15 3 2

Major groove minor groove platform; mini C-loop

344 0.00 -385.64 6 3

Minor groove platform

345 0.00 -386.22 16 15

346 0.00 -387.42 11 9

Part of G-quadruplex

347 0.00 -391.45 13 13

348 0.00 -392.45 15 13

349 0.00 -393.80 14 14

10x8 Sarcin-Ricin; G-bulge

350 0.00 -396.54 12 11

351 0.00 -397.94 15 15

352 0.00 -399.70 13 13

353 0.00 -399.76 14 13

9x8 Sarcin-Ricin with GA cWW pair; G-bulge

354 0.00 -400.33 13 12

Kink-turn related

355 0.00 -401.14 5 3

Major groove minor groove platform with intercalation; mini C-loop

356 0.00 -401.48 15 12

357 0.00 -402.38 12 12

358 0.00 -403.18 13 13

359 0.00 -403.22 7 5

Major groove intercalation

360 0.00 -404.63 14 13

361 0.00 -406.44 16 16

362 0.00 -406.93 16 14

363 0.00 -415.86 13 13

364 0.00 -417.07 8 6

365 0.00 -417.46 18 18

Kink-turn

366 0.00 -419.27 13 13

367 0.00 -419.28 15 13

368 0.00 -420.68 16 16

369 0.00 -420.73 12 10

Minor groove platform related

370 0.00 -425.37 17 16

371 0.00 -432.36 17 16

372 0.00 -439.36 14 14

Bacterial 5S Loop E

373 0.00 -442.10 10 10

Kink-turn with non-sequential stacking

374 0.00 -449.65 17 17

375 0.00 -452.37 15 14

9x9 Sarcin-Ricin with pseudoknotted region; G-bulge

376 0.00 -457.65 14 13

377 0.00 -460.06 12 11

378 0.00 -463.83 12 11

379 0.00 -463.97 14 14

380 0.00 -464.03 14 13

381 0.00 -467.79 12 12

382 0.00 -469.67 15 14

383 0.00 -471.11 15 14

7x11 Sarcin-Ricin with pseudoknotted region; G-bulge

384 0.00 -471.14 19 18

385 0.00 -474.02 20 19

386 0.00 -474.47 16 15

Pseudoknot

387 0.00 -483.06 19 19

388 0.00 -486.72 7 7

389 0.00 -497.66 19 19

390 0.00 -503.68 9 8

Kink-turn

391 0.00 -505.91 14 14

392 0.00 -513.16 5 4

393 0.00 -541.30 20 19

Kink-turn related

394 0.00 -549.28 16 16

395 0.00 -563.54 22 22

396 0.00 -591.67 7 6

Symmetric double minor groove platform

397 0.00 -594.78 21 21

398 0.00 -594.79 15 14

399 0.00 -597.09 23 22

400 0.00 -628.18 24 24

401 0.00 -648.98 25 24

402 0.00 -655.16 22 21

403 0.00 -6252.91 11 9

404 0.00 -7002.63 8 5

C-loop with bulged stacked A's

405 0.00 -8880.71 4 4

C-loop

406 0.00 -9999.00 3 3

C-loop

407 0.00 -9999.00 21 21

408 0.00 -9999.00 18 18

409 0.00 -9999.00 23 23

410 0.00 -9999.00 4 2

411 0.00 -9999.00 7 4

Coloring options: