JAR3D
Query RF03087-CCF-3.98 completed
Run on Motif Atlas Version
using the Rfam secondary structure. Run with the CaCoFold secondary structure.
Rfam family RF03087 maps to these 30 chains: 9ISV|1|A, 9J3R|1|A, 9J3R|1|B, 9J3R|1|C, 9J3R|1|D, 9J3T|1|A, 9J3T|1|B, 9J3T|1|C, 9J3T|1|D, 9J3T|1|E, 9J3T|1|F, 9J3T|1|G, 9J3T|1|H, 9MM6|1|A, 9MM6|1|E, 9MM6|1|I, 9MM6|1|M, 9MM6|1|Q, 9MM6|1|U, 9MM6|1|Y, 9MM6|1|c, 9MME|1|U, 9MME|1|Y, 9MME|1|c, 9MME|1|g, 9MME|1|k, 9MME|1|o, 9MME|1|s, 9MME|1|w, 9MMG|1|c See more about them at RNA 3D Hub by filtering on the chain or the Rfam family.
Loop 8 Internal loop
Column numbers: 87-88, 308-346 - View nucleotides in PDB file(s)
Scored sequences and counts
UA*UUGAGGGUGU----------------------------A 22
CG*A-------------------------------------G 13
CU*G-------------------------------------G 6
UU*G-------------------------------------A 5
CG*AUCACCCCUGUGUCAA----------------------G 4
UA*UUGAGGGCGU----------------------------A 4
GG*A-------------------------------------C 4
CC*-------------------------------------GG 3
UC*A-------------------------------------G 3
UG*A-------------------------------------G 3
AC*G------------------------------------GU 2
GU*GG------------------------------------C 2
CC*G-------------------------------------G 2
CG*G-------------------------------------G 2
CU*A-------------------------------------G 2
UC*G-------------------------------------A 2
UC*G-------------------------------------G 2
UU*AGAUGAAGCUUAAAGGUUACGGAAAGUACCAAUAGUUAG 1
CC*UAUUCGCCUUUAAUUAGACGCUAUG-------------G 1
UA*UUGAGAGUGU----------------------------A 1
UG*----------------------------UUGAGGGUGUA 1
UG*UUGAGGGUGU----------------------------A 1
AC*UUGAGAGUG-----------------------------U 1
UC*GGAAAGAG------------------------------A 1
CU*CAAG----------------------------------G 1
AC*U-----------------------------------GGG 1
UC*AC----------------------------------G-G 1
AU*------------------------------------GGU 1
CC*U------------------------------------GG 1
AC*G-------------------------------------U 1
AU*-------------------------------------UU 1
CA*G-------------------------------------G 1
CU*U-------------------------------------G 1
GA*U-------------------------------------U 1
GC*G-------------------------------------C 1
GU*A-------------------------------------C 1
GU*G-------------------------------------C 1
UA*G-------------------------------------G 1
UU*-------------------------------------AA 1
UU*G-------------------------------------G 1
Omitted sequenced and counts
GG*--------------------------------------C 39
UG*--------------------------------------G 38
CG*--------------------------------------G 27
UG*--------------------------------------C 13
AG*--------------------------------------U 10
UU*--------------------------------------A 7
GC*--------------------------------------C 6
UC*--------------------------------------A 6
CU*--------------------------------------G 5
UG*--------------------------------------A 5
CC*--------------------------------------G 4
UU*--------------------------------------G 4
AA*--------------------------------------U 3
AC*--------------------------------------U 3
GA*--------------------------------------C 2
GG*--------------------------------------U 2
UC*--------------------------------------G 2
-A*UUGAGGGUGU----------------------------- 1
AU*--------------------------------------U 1
CA*--------------------------------------G 1
CG*--------------------------------------A 1
GG*--------------------------------------A 1
UA*--------------------------------------G 1
UA*--------------------------------------U 1
A-*--------------------------------------U 1
CA*--------------------------------------- 1
-C*--------------------------------------- 1
Click on headings to reorder table
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_07039.3
Basepair signature:
|
59.62 | -2975.83 | 3 | 1 |
Major groove platform |
| 2 |
Motif group IL_84476.1
Basepair signature:
|
46.15 | -3812.75 | 4 | 2 |
Multiple bulged bases |
| 3 |
Motif group IL_81831.1
Basepair signature:
|
31.73 | -3727.35 | 4 | 1 |
Intercalated cWS |
| 4 |
Motif group IL_42771.1
Basepair signature:
|
31.73 | -3829.73 | 3 | 1 |
Multiple bulged bases |
| 5 |
Motif group IL_00225.13
Basepair signature:
|
29.81 | -3847.42 | 2 | 1 |
Single bulged G |
| 6 |
Motif group IL_73452.2
Basepair signature:
|
27.88 | -3619.34 | 4 | 1 |
|
| 7 |
Motif group IL_19852.1
Basepair signature:
|
22.12 | -401.70 | 10.5 | 9 |
Part of G-quadruplex |
| 8 |
Motif group IL_90729.1
Basepair signature:
|
19.23 | -3731.36 | 2 | 1 |
Single stack bend |
| 9 |
Motif group IL_33761.2
Basepair signature:
|
19.23 | -3733.56 | 4 | 1 |
|
| 10 |
Motif group IL_66635.5
Basepair signature:
|
18.27 | -824.92 | 3 | 1 |
Major groove intercalation |
| 11 |
Motif group IL_16386.4
Basepair signature:
|
18.27 | -3842.42 | 4 | 1 |
|
| 12 |
Motif group IL_26793.1
Basepair signature:
|
18.27 | -3844.98 | 3 | 1 |
Single stack bend |
| 13 |
Motif group IL_31737.3
Basepair signature:
|
17.31 | -3848.93 | 3 | 1 |
Stack and bulge |
| 14 |
Motif group IL_89505.4
Basepair signature:
|
14.42 | -3855.70 | 2 | 1 |
Single bulged U |
| 15 |
Motif group IL_61258.15
Basepair signature:
|
14.42 | -3872.43 | 3 | 1 |
Single bulged C |
| 16 |
Motif group IL_48076.6
Basepair signature:
|
10.58 | -3734.74 | 2 | 1 |
Major groove platform |
| 17 |
Motif group IL_31462.6
Basepair signature:
|
8.65 | -3899.40 | 2 | 1 |
Single bulged A |
| 18 |
Motif group IL_82107.4
Basepair signature:
|
5.77 | -3861.11 | 3 | 2 |
Multiple bulged bases |
| 19 |
Motif group IL_10569.1
Basepair signature:
|
5.77 | -3930.38 | 3.5 | 1 |
|
| 20 |
Motif group IL_63775.1
Basepair signature:
|
4.81 | -3916.88 | 5 | 1 |
|
| 21 |
Motif group IL_51454.3
Basepair signature:
|
1.92 | -3745.53 | 2 | 1 |
Minor groove platform |
| 22 |
Motif group IL_44465.1
Basepair signature:
|
1.92 | -3798.76 | 3 | 2 |
Isolated non-canonical cWW contact |
| 23 |
Motif group IL_18354.1
Basepair signature:
|
0.96 | -262.27 | 9 | 8 |
|
| 24 |
Motif group IL_07171.1
Basepair signature:
|
0.96 | -778.55 | 5 | 3 |
Bulged stacked bases |
| 25 |
Motif group IL_95583.2
Basepair signature:
|
0.96 | -3777.59 | 3.5 | 2 |
Minor groove platform, major groove intercalation |
| 26 |
Motif group IL_42626.2
Basepair signature:
|
0.96 | -3944.19 | 3 | 2 |
|
| 27 |
Motif group IL_21173.1
Basepair signature:
|
0.00 | -247.36 | 9 | 7 |
|
| 28 |
Motif group IL_85498.1
Basepair signature:
|
0.00 | -254.33 | 10 | 9 |
|
| 29 |
Motif group IL_54896.1
Basepair signature:
|
0.00 | -254.87 | 10 | 9 |
|
| 30 |
Motif group IL_82968.1
Basepair signature:
|
0.00 | -255.02 | 9 | 7 |
|
| 31 |
Motif group IL_15218.1
Basepair signature:
|
0.00 | -281.07 | 10 | 9 |
|
| 32 |
Motif group IL_80209.1
Basepair signature:
|
0.00 | -283.63 | 11 | 10 |
|
| 33 |
Motif group IL_51191.1
Basepair signature:
|
0.00 | -288.07 | 7 | 6 |
|
| 34 |
Motif group IL_55917.1
Basepair signature:
|
0.00 | -294.78 | 8 | 7 |
|
| 35 |
Motif group IL_09570.1
Basepair signature:
|
0.00 | -295.81 | 10 | 8 |
|
| 36 |
Motif group IL_53787.1
Basepair signature:
|
0.00 | -303.56 | 12 | 11 |
Pseudoknot |
| 37 |
Motif group IL_64048.1
Basepair signature:
|
0.00 | -304.21 | 9 | 8 |
|
| 38 |
Motif group IL_17973.1
Basepair signature:
|
0.00 | -304.80 | 16 | 16 |
|
| 39 |
Motif group IL_37603.1
Basepair signature:
|
0.00 | -306.43 | 10 | 7 |
|
| 40 |
Motif group IL_38969.1
Basepair signature:
|
0.00 | -311.27 | 10 | 8 |
Reverse kink-turn related |
| 41 |
Motif group IL_19897.3
Basepair signature:
|
0.00 | -311.32 | 8 | 7 |
|
| 42 |
Motif group IL_84665.1
Basepair signature:
|
0.00 | -311.41 | 11 | 11 |
|
| 43 |
Motif group IL_60657.1
Basepair signature:
|
0.00 | -314.66 | 12 | 12 |
|
| 44 |
Motif group IL_64842.1
Basepair signature:
|
0.00 | -315.52 | 10 | 7 |
|
| 45 |
Motif group IL_88974.1
Basepair signature:
|
0.00 | -316.78 | 10 | 9 |
|
| 46 |
Motif group IL_74184.1
Basepair signature:
|
0.00 | -321.90 | 9 | 8 |
|
| 47 |
Motif group IL_27393.10
Basepair signature:
|
0.00 | -322.40 | 10 | 6 |
|
| 48 |
Motif group IL_95811.1
Basepair signature:
|
0.00 | -322.82 | 9 | 7 |
Vitamin B12 Aptamer |
| 49 |
Motif group IL_04650.2
Basepair signature:
|
0.00 | -325.67 | 10 | 8 |
|
| 50 |
Motif group IL_80412.1
Basepair signature:
|
0.00 | -327.67 | 10 | 8 |
|
| 51 |
Motif group IL_32056.1
Basepair signature:
|
0.00 | -328.55 | 10 | 9 |
|
| 52 |
Motif group IL_91636.1
Basepair signature:
|
0.00 | -328.68 | 9 | 7 |
|
| 53 |
Motif group IL_86136.1
Basepair signature:
|
0.00 | -328.88 | 9 | 7 |
|
| 54 |
Motif group IL_85222.1
Basepair signature:
|
0.00 | -330.42 | 10 | 8 |
|
| 55 |
Motif group IL_53596.1
Basepair signature:
|
0.00 | -331.67 | 9 | 7 |
|
| 56 |
Motif group IL_88072.1
Basepair signature:
|
0.00 | -332.77 | 10 | 9 |
|
| 57 |
Motif group IL_73002.1
Basepair signature:
|
0.00 | -334.01 | 14 | 14 |
|
| 58 |
Motif group IL_87290.1
Basepair signature:
|
0.00 | -336.30 | 17 | 16 |
Kink-turn related |
| 59 |
Motif group IL_69271.3
Basepair signature:
|
0.00 | -336.43 | 10 | 10 |
|
| 60 |
Motif group IL_99380.1
Basepair signature:
|
0.00 | -336.87 | 7 | 4 |
|
| 61 |
Motif group IL_33711.1
Basepair signature:
|
0.00 | -337.57 | 8 | 7 |
Minor groove platform |
| 62 |
Motif group IL_91592.1
Basepair signature:
|
0.00 | -340.58 | 8 | 6 |
|
| 63 |
Motif group IL_46112.1
Basepair signature:
|
0.00 | -342.90 | 10 | 7 |
|
| 64 |
Motif group IL_26598.1
Basepair signature:
|
0.00 | -343.34 | 8 | 6 |
|
| 65 |
Motif group IL_04332.3
Basepair signature:
|
0.00 | -348.72 | 12 | 12 |
|
| 66 |
Motif group IL_69145.3
Basepair signature:
|
0.00 | -349.83 | 9 | 6 |
Pseudoknot |
| 67 |
Motif group IL_33623.1
Basepair signature:
|
0.00 | -350.75 | 9 | 8 |
|
| 68 |
Motif group IL_64403.1
Basepair signature:
|
0.00 | -350.88 | 12 | 12 |
|
| 69 |
Motif group IL_88017.1
Basepair signature:
|
0.00 | -352.04 | 8 | 5 |
|
| 70 |
Motif group IL_97697.1
Basepair signature:
|
0.00 | -353.11 | 11 | 9 |
Reverse turn |
| 71 |
Motif group IL_16665.1
Basepair signature:
|
0.00 | -359.73 | 10 | 10 |
|
| 72 |
Motif group IL_13358.1
Basepair signature:
|
0.00 | -366.44 | 12 | 10 |
|
| 73 |
Motif group IL_76758.2
Basepair signature:
|
0.00 | -368.90 | 7 | 6 |
Intercalated tWH |
| 74 |
Motif group IL_78472.1
Basepair signature:
|
0.00 | -371.19 | 11 | 9 |
|
| 75 |
Motif group IL_46086.1
Basepair signature:
|
0.00 | -372.60 | 8 | 5 |
|
| 76 |
Motif group IL_85652.1
Basepair signature:
|
0.00 | -375.89 | 10 | 8 |
|
| 77 |
Motif group IL_90346.1
Basepair signature:
|
0.00 | -376.30 | 9 | 6 |
|
| 78 |
Motif group IL_42218.2
Basepair signature:
|
0.00 | -382.15 | 12 | 12 |
|
| 79 |
Motif group IL_43140.1
Basepair signature:
|
0.00 | -382.42 | 9 | 8 |
|
| 80 |
Motif group IL_49612.1
Basepair signature:
|
0.00 | -383.79 | 8 | 6 |
|
| 81 |
Motif group IL_43467.1
Basepair signature:
|
0.00 | -385.92 | 15 | 15 |
Pseudoknot |
| 82 |
Motif group IL_41853.1
Basepair signature:
|
0.00 | -386.97 | 10.5 | 9 |
|
| 83 |
Motif group IL_54177.4
Basepair signature:
|
0.00 | -388.13 | 13 | 12 |
|
| 84 |
Motif group IL_74957.1
Basepair signature:
|
0.00 | -389.22 | 9 | 7 |
cWH basepair with bulged bases |
| 85 |
Motif group IL_04307.1
Basepair signature:
|
0.00 | -390.40 | 13 | 12 |
|
| 86 |
Motif group IL_06029.1
Basepair signature:
|
0.00 | -391.56 | 19 | 18 |
Kink-turn |
| 87 |
Motif group IL_44438.1
Basepair signature:
|
0.00 | -394.91 | 9 | 8 |
|
| 88 |
Motif group IL_54050.1
Basepair signature:
|
0.00 | -395.85 | 11.5 | 11 |
|
| 89 |
Motif group IL_42778.1
Basepair signature:
|
0.00 | -398.17 | 9 | 8 |
|
| 90 |
Motif group IL_31084.1
Basepair signature:
|
0.00 | -398.66 | 10 | 8 |
|
| 91 |
Motif group IL_31915.1
Basepair signature:
|
0.00 | -401.31 | 13 | 11 |
|
| 92 |
Motif group IL_81392.1
Basepair signature:
|
0.00 | -406.40 | 17 | 16 |
|
| 93 |
Motif group IL_85630.1
Basepair signature:
|
0.00 | -407.38 | 12 | 11 |
|
| 94 |
Motif group IL_78349.3
Basepair signature:
|
0.00 | -413.72 | 11 | 10 |
|
| 95 |
Motif group IL_60448.1
Basepair signature:
|
0.00 | -426.63 | 16 | 16 |
|
| 96 |
Motif group IL_76460.1
Basepair signature:
|
0.00 | -428.94 | 18 | 18 |
|
| 97 |
Motif group IL_30441.1
Basepair signature:
|
0.00 | -434.73 | 14 | 13 |
|
| 98 |
Motif group IL_59302.1
Basepair signature:
|
0.00 | -435.36 | 7 | 5 |
|
| 99 |
Motif group IL_13394.1
Basepair signature:
|
0.00 | -439.47 | 19 | 19 |
|
| 100 |
Motif group IL_38186.6
Basepair signature:
|
0.00 | -440.75 | 6 | 5 |
|
| 101 |
Motif group IL_05472.1
Basepair signature:
|
0.00 | -442.00 | 13 | 12 |
|
| 102 |
Motif group IL_96303.1
Basepair signature:
|
0.00 | -442.51 | 14 | 13 |
|
| 103 |
Motif group IL_22854.4
Basepair signature:
|
0.00 | -443.38 | 10 | 10 |
|
| 104 |
Motif group IL_05192.4
Basepair signature:
|
0.00 | -445.27 | 7 | 6 |
|
| 105 |
Motif group IL_15991.1
Basepair signature:
|
0.00 | -447.58 | 19 | 19 |
|
| 106 |
Motif group IL_28304.1
Basepair signature:
|
0.00 | -447.96 | 14 | 14 |
|
| 107 |
Motif group IL_74746.1
Basepair signature:
|
0.00 | -448.79 | 13 | 12 |
|
| 108 |
Motif group IL_19516.1
Basepair signature:
|
0.00 | -449.04 | 16 | 15 |
Pseudoknot |
| 109 |
Motif group IL_04073.1
Basepair signature:
|
0.00 | -453.06 | 16 | 16 |
|
| 110 |
Motif group IL_41203.4
Basepair signature:
|
0.00 | -463.77 | 6 | 6 |
SSU/LSU pseudoknot |
| 111 |
Motif group IL_50715.3
Basepair signature:
|
0.00 | -463.99 | 19 | 19 |
|
| 112 |
Motif group IL_30730.1
Basepair signature:
|
0.00 | -465.16 | 9 | 8 |
|
| 113 |
Motif group IL_82706.1
Basepair signature:
|
0.00 | -471.81 | 8.5 | 6 |
|
| 114 |
Motif group IL_80298.1
Basepair signature:
|
0.00 | -486.93 | 23 | 22 |
|
| 115 |
Motif group IL_42231.1
Basepair signature:
|
0.00 | -487.73 | 13 | 13 |
|
| 116 |
Motif group IL_36729.1
Basepair signature:
|
0.00 | -490.22 | 13 | 13 |
|
| 117 |
Motif group IL_91698.1
Basepair signature:
|
0.00 | -497.90 | 14 | 13 |
|
| 118 |
Motif group IL_21630.1
Basepair signature:
|
0.00 | -498.07 | 13 | 13 |
|
| 119 |
Motif group IL_59049.1
Basepair signature:
|
0.00 | -498.86 | 14 | 13 |
|
| 120 |
Motif group IL_34739.3
Basepair signature:
|
0.00 | -508.40 | 22 | 22 |
|
| 121 |
Motif group IL_93889.1
Basepair signature:
|
0.00 | -511.22 | 17 | 17 |
|
| 122 |
Motif group IL_33141.1
Basepair signature:
|
0.00 | -514.06 | 9 | 7 |
|
| 123 |
Motif group IL_24499.1
Basepair signature:
|
0.00 | -524.27 | 9 | 8 |
|
| 124 |
Motif group IL_44874.1
Basepair signature:
|
0.00 | -543.82 | 9 | 7 |
tSH-tHW |
| 125 |
Motif group IL_56317.1
Basepair signature:
|
0.00 | -546.21 | 9 | 7 |
|
| 126 |
Motif group IL_70670.1
Basepair signature:
|
0.00 | -547.67 | 15 | 14 |
9x9 Sarcin-Ricin with pseudoknotted region; G-bulge |
| 127 |
Motif group IL_82426.6
Basepair signature:
|
0.00 | -559.38 | 12 | 12 |
|
| 128 |
Motif group IL_47087.1
Basepair signature:
|
0.00 | -560.63 | 9 | 7 |
Kink-turn related |
| 129 |
Motif group IL_74051.1
Basepair signature:
|
0.00 | -561.77 | 10 | 8 |
Kink-turn |
| 130 |
Motif group IL_59258.1
Basepair signature:
|
0.00 | -561.84 | 9 | 8 |
|
| 131 |
Motif group IL_77278.1
Basepair signature:
|
0.00 | -564.16 | 11 | 10 |
|
| 132 |
Motif group IL_82683.2
Basepair signature:
|
0.00 | -564.70 | 9 | 6 |
|
| 133 |
Motif group IL_73789.1
Basepair signature:
|
0.00 | -568.10 | 8 | 5 |
|
| 134 |
Motif group IL_45444.1
Basepair signature:
|
0.00 | -568.27 | 8 | 6 |
|
| 135 |
Motif group IL_58960.1
Basepair signature:
|
0.00 | -568.80 | 8 | 7 |
|
| 136 |
Motif group IL_25186.4
Basepair signature:
|
0.00 | -568.85 | 8 | 7 |
|
| 137 |
Motif group IL_88082.1
Basepair signature:
|
0.00 | -570.05 | 8 | 6 |
|
| 138 |
Motif group IL_31561.1
Basepair signature:
|
0.00 | -571.71 | 10 | 9 |
|
| 139 |
Motif group IL_07173.1
Basepair signature:
|
0.00 | -574.11 | 7 | 5 |
|
| 140 |
Motif group IL_69229.3
Basepair signature:
|
0.00 | -574.76 | 9 | 9 |
Kink-turn |
| 141 |
Motif group IL_89312.1
Basepair signature:
|
0.00 | -575.41 | 10 | 9 |
|
| 142 |
Motif group IL_77870.1
Basepair signature:
|
0.00 | -575.71 | 11 | 9 |
|
| 143 |
Motif group IL_22829.2
Basepair signature:
|
0.00 | -579.10 | 8 | 7 |
|
| 144 |
Motif group IL_20047.1
Basepair signature:
|
0.00 | -580.49 | 10 | 10 |
|
| 145 |
Motif group IL_43622.1
Basepair signature:
|
0.00 | -582.85 | 7 | 5 |
|
| 146 |
Motif group IL_96332.5
Basepair signature:
|
0.00 | -583.50 | 8 | 6 |
|
| 147 |
Motif group IL_54041.2
Basepair signature:
|
0.00 | -587.77 | 10 | 9 |
tHW-tHW cross-strand stack |
| 148 |
Motif group IL_69000.1
Basepair signature:
|
0.00 | -589.46 | 8 | 5 |
|
| 149 |
Motif group IL_25412.1
Basepair signature:
|
0.00 | -589.58 | 8 | 5 |
Major groove intercalation |
| 150 |
Motif group IL_16458.4
Basepair signature:
|
0.00 | -591.99 | 10 | 9 |
Sarcin-Ricin target in LSU H95; G-bulge |
| 151 |
Motif group IL_23038.1
Basepair signature:
|
0.00 | -602.90 | 11 | 9 |
|
| 152 |
Motif group IL_61286.1
Basepair signature:
|
0.00 | -603.12 | 12 | 10 |
8x6 Sarcin-Ricin with inserted A; G-bulge |
| 153 |
Motif group IL_15107.1
Basepair signature:
|
0.00 | -603.56 | 15 | 15 |
|
| 154 |
Motif group IL_11415.1
Basepair signature:
|
0.00 | -604.09 | 7 | 4 |
|
| 155 |
Motif group IL_70801.1
Basepair signature:
|
0.00 | -605.66 | 11 | 9 |
|
| 156 |
Motif group IL_81731.1
Basepair signature:
|
0.00 | -606.36 | 13 | 13 |
|
| 157 |
Motif group IL_34737.1
Basepair signature:
|
0.00 | -612.66 | 9 | 6 |
|
| 158 |
Motif group IL_04736.1
Basepair signature:
|
0.00 | -613.27 | 11 | 10 |
|
| 159 |
Motif group IL_18487.1
Basepair signature:
|
0.00 | -613.54 | 10 | 9 |
|
| 160 |
Motif group IL_94351.1
Basepair signature:
|
0.00 | -613.84 | 9 | 7 |
|
| 161 |
Motif group IL_49867.1
Basepair signature:
|
0.00 | -615.39 | 13 | 11 |
|
| 162 |
Motif group IL_83149.1
Basepair signature:
|
0.00 | -616.25 | 24 | 24 |
|
| 163 |
Motif group IL_70376.1
Basepair signature:
|
0.00 | -619.26 | 6 | 4 |
|
| 164 |
Motif group IL_29471.1
Basepair signature:
|
0.00 | -619.36 | 7 | 6 |
|
| 165 |
Motif group IL_29826.1
Basepair signature:
|
0.00 | -619.73 | 24 | 24 |
|
| 166 |
Motif group IL_47108.1
Basepair signature:
|
0.00 | -622.77 | 8 | 6 |
|
| 167 |
Motif group IL_04638.3
Basepair signature:
|
0.00 | -622.82 | 10 | 10 |
tSH-tHS-tHW |
| 168 |
Motif group IL_99498.1
Basepair signature:
|
0.00 | -624.09 | 9 | 7 |
|
| 169 |
Motif group IL_21001.1
Basepair signature:
|
0.00 | -624.17 | 8 | 6 |
|
| 170 |
Motif group IL_70627.3
Basepair signature:
|
0.00 | -628.04 | 8 | 7 |
UAA/GAN related |
| 171 |
Motif group IL_21667.1
Basepair signature:
|
0.00 | -631.40 | 9 | 7 |
|
| 172 |
Motif group IL_70335.1
Basepair signature:
|
0.00 | -631.54 | 8 | 5 |
|
| 173 |
Motif group IL_88116.2
Basepair signature:
|
0.00 | -632.22 | 11 | 10 |
|
| 174 |
Motif group IL_09908.1
Basepair signature:
|
0.00 | -637.25 | 10.5 | 7 |
Reverse kink-turn |
| 175 |
Motif group IL_49971.1
Basepair signature:
|
0.00 | -640.32 | 10 | 8 |
|
| 176 |
Motif group IL_68243.1
Basepair signature:
|
0.00 | -642.69 | 10.5 | 10 |
|
| 177 |
Motif group IL_33886.1
Basepair signature:
|
0.00 | -645.32 | 9 | 8 |
Kink-turn with embedded cWW pair |
| 178 |
Motif group IL_58350.1
Basepair signature:
|
0.00 | -648.61 | 13 | 11 |
|
| 179 |
Motif group IL_43547.1
Basepair signature:
|
0.00 | -652.37 | 14 | 14 |
10x8 Sarcin-Ricin; G-bulge |
| 180 |
Motif group IL_09129.2
Basepair signature:
|
0.00 | -652.67 | 12 | 10 |
|
| 181 |
Motif group IL_51265.3
Basepair signature:
|
0.00 | -654.31 | 8 | 7 |
Kink-turn from U4 |
| 182 |
Motif group IL_29357.1
Basepair signature:
|
0.00 | -661.00 | 15 | 15 |
|
| 183 |
Motif group IL_14177.2
Basepair signature:
|
0.00 | -663.02 | 7 | 5 |
|
| 184 |
Motif group IL_41756.4
Basepair signature:
|
0.00 | -666.67 | 10.5 | 10 |
8x6 Sarcin-Ricin with inserted Y; G-bulge |
| 185 |
Motif group IL_74367.1
Basepair signature:
|
0.00 | -666.85 | 8 | 6 |
|
| 186 |
Motif group IL_01176.1
Basepair signature:
|
0.00 | -668.24 | 10 | 7 |
|
| 187 |
Motif group IL_64900.1
Basepair signature:
|
0.00 | -670.87 | 12 | 11 |
Kink-turn |
| 188 |
Motif group IL_73700.1
Basepair signature:
|
0.00 | -671.45 | 14 | 12 |
|
| 189 |
Motif group IL_29198.2
Basepair signature:
|
0.00 | -672.36 | 11 | 10 |
7x7 Sarcin-Ricin with intercalated A; G-bulge |
| 190 |
Motif group IL_70411.2
Basepair signature:
|
0.00 | -672.69 | 8 | 7 |
|
| 191 |
Motif group IL_70923.9
Basepair signature:
|
0.00 | -675.82 | 9 | 9 |
Kink-turn |
| 192 |
Motif group IL_92634.2
Basepair signature:
|
0.00 | -677.33 | 6 | 4 |
|
| 193 |
Motif group IL_12566.4
Basepair signature:
|
0.00 | -678.04 | 7 | 5 |
|
| 194 |
Motif group IL_58126.1
Basepair signature:
|
0.00 | -680.48 | 12 | 11 |
|
| 195 |
Motif group IL_06300.1
Basepair signature:
|
0.00 | -685.36 | 7 | 5 |
|
| 196 |
Motif group IL_82292.1
Basepair signature:
|
0.00 | -686.58 | 9 | 8 |
|
| 197 |
Motif group IL_87211.1
Basepair signature:
|
0.00 | -692.87 | 7 | 4 |
|
| 198 |
Motif group IL_67623.1
Basepair signature:
|
0.00 | -693.51 | 12 | 10 |
Minor groove platform related |
| 199 |
Motif group IL_89047.1
Basepair signature:
|
0.00 | -701.35 | 14 | 13 |
|
| 200 |
Motif group IL_21200.1
Basepair signature:
|
0.00 | -702.45 | 7 | 6 |
tSH-tHW |
| 201 |
Motif group IL_89984.3
Basepair signature:
|
0.00 | -709.33 | 7 | 4 |
|
| 202 |
Motif group IL_34470.3
Basepair signature:
|
0.00 | -712.17 | 13 | 13 |
9x8 Sarcin-Ricin with GA cWW pair; G-bulge |
| 203 |
Motif group IL_16218.2
Basepair signature:
|
0.00 | -713.78 | 8 | 6 |
|
| 204 |
Motif group IL_26685.1
Basepair signature:
|
0.00 | -716.15 | 6 | 3 |
Multiple bulged bases |
| 205 |
Motif group IL_98347.1
Basepair signature:
|
0.00 | -719.63 | 8 | 5 |
|
| 206 |
Motif group IL_18472.4
Basepair signature:
|
0.00 | -720.40 | 9 | 7 |
|
| 207 |
Motif group IL_20463.1
Basepair signature:
|
0.00 | -723.91 | 15 | 14 |
7x11 Sarcin-Ricin with pseudoknotted region; G-bulge |
| 208 |
Motif group IL_67780.1
Basepair signature:
|
0.00 | -724.67 | 8 | 6 |
|
| 209 |
Motif group IL_57741.1
Basepair signature:
|
0.00 | -726.77 | 14 | 13 |
|
| 210 |
Motif group IL_11344.2
Basepair signature:
|
0.00 | -726.94 | 8 | 6 |
180 degree turn |
| 211 |
Motif group IL_31558.1
Basepair signature:
|
0.00 | -728.19 | 7 | 5 |
|
| 212 |
Motif group IL_62012.1
Basepair signature:
|
0.00 | -731.95 | 7 | 5 |
Decoding loop related |
| 213 |
Motif group IL_47972.1
Basepair signature:
|
0.00 | -749.45 | 6 | 4 |
|
| 214 |
Motif group IL_66798.2
Basepair signature:
|
0.00 | -756.54 | 6 | 6 |
AAA cross-strand stack |
| 215 |
Motif group IL_10389.1
Basepair signature:
|
0.00 | -761.96 | 6 | 4 |
|
| 216 |
Motif group IL_75294.1
Basepair signature:
|
0.00 | -764.79 | 7 | 5 |
|
| 217 |
Motif group IL_11399.2
Basepair signature:
|
0.00 | -776.67 | 6 | 5 |
|
| 218 |
Motif group IL_49714.1
Basepair signature:
|
0.00 | -784.15 | 8 | 5 |
Major groove intercalation |
| 219 |
Motif group IL_66663.1
Basepair signature:
|
0.00 | -788.75 | 14 | 14 |
|
| 220 |
Motif group IL_19668.1
Basepair signature:
|
0.00 | -792.80 | 6 | 5 |
Isolated non-canonical cWW pair |
| 221 |
Motif group IL_38394.1
Basepair signature:
|
0.00 | -817.13 | 7 | 6 |
|
| 222 |
Motif group IL_71598.1
Basepair signature:
|
0.00 | -823.78 | 8 | 5 |
|
| 223 |
Motif group IL_47074.2
Basepair signature:
|
0.00 | -848.92 | 4 | 2 |
|
| 224 |
Motif group IL_00881.1
Basepair signature:
|
0.00 | -856.03 | 5 | 2 |
|
| 225 |
Motif group IL_64858.3
Basepair signature:
|
0.00 | -856.43 | 21 | 21 |
|
| 226 |
Motif group IL_94967.1
Basepair signature:
|
0.00 | -864.66 | 7 | 3 |
|
| 227 |
Motif group IL_20031.1
Basepair signature:
|
0.00 | -865.18 | 5 | 3 |
|
| 228 |
Motif group IL_29346.2
Basepair signature:
|
0.00 | -870.62 | 5 | 3 |
Left turn |
| 229 |
Motif group IL_22551.4
Basepair signature:
|
0.00 | -879.05 | 4 | 2 |
|
| 230 |
Motif group IL_79895.1
Basepair signature:
|
0.00 | -884.65 | 5 | 2 |
|
| 231 |
Motif group IL_82741.2
Basepair signature:
|
0.00 | -889.32 | 6 | 3 |
|
| 232 |
Motif group IL_25463.1
Basepair signature:
|
0.00 | -890.48 | 6 | 4 |
|
| 233 |
Motif group IL_73355.1
Basepair signature:
|
0.00 | -903.51 | 6 | 2 |
|
| 234 |
Motif group IL_76709.2
Basepair signature:
|
0.00 | -905.43 | 4 | 2 |
|
| 235 |
Motif group IL_61476.2
Basepair signature:
|
0.00 | -908.05 | 5.5 | 4 |
|
| 236 |
Motif group IL_14368.1
Basepair signature:
|
0.00 | -918.20 | 5 | 2 |
Major groove platform with intercalated tWH |
| 237 |
Motif group IL_89021.2
Basepair signature:
|
0.00 | -923.21 | 8 | 6 |
UAA/GAN |
| 238 |
Motif group IL_92446.2
Basepair signature:
|
0.00 | -925.49 | 7 | 4 |
|
| 239 |
Motif group IL_49061.1
Basepair signature:
|
0.00 | -938.65 | 5 | 4 |
|
| 240 |
Motif group IL_90351.1
Basepair signature:
|
0.00 | -956.56 | 4 | 3 |
|
| 241 |
Motif group IL_99358.1
Basepair signature:
|
0.00 | -960.75 | 4 | 3 |
|
| 242 |
Motif group IL_46387.1
Basepair signature:
|
0.00 | -964.80 | 6 | 4 |
|
| 243 |
Motif group IL_51387.2
Basepair signature:
|
0.00 | -976.64 | 4 | 3 |
|
| 244 |
Motif group IL_81522.2
Basepair signature:
|
0.00 | -977.15 | 5 | 3 |
Major groove minor groove platform with intercalation; mini C-loop |
| 245 |
Motif group IL_31531.3
Basepair signature:
|
0.00 | -997.98 | 4 | 3 |
Decoding loop related |
| 246 |
Motif group IL_48444.6
Basepair signature:
|
0.00 | -1001.14 | 6 | 5 |
|
| 247 |
Motif group IL_64231.5
Basepair signature:
|
0.00 | -1057.26 | 6 | 5 |
|
| 248 |
Motif group IL_79846.1
Basepair signature:
|
0.00 | -1618.20 | 16 | 15 |
|
| 249 |
Motif group IL_37752.1
Basepair signature:
|
0.00 | -1704.00 | 12 | 11 |
|
| 250 |
Motif group IL_65653.1
Basepair signature:
|
0.00 | -1720.25 | 14 | 14 |
|
| 251 |
Motif group IL_43858.1
Basepair signature:
|
0.00 | -1745.18 | 13 | 13 |
|
| 252 |
Motif group IL_61249.1
Basepair signature:
|
0.00 | -1774.47 | 16 | 16 |
|
| 253 |
Motif group IL_31504.1
Basepair signature:
|
0.00 | -1827.13 | 16 | 16 |
|
| 254 |
Motif group IL_84694.2
Basepair signature:
|
0.00 | -1847.67 | 14 | 13 |
tSH-tHW-tHH-tHS |
| 255 |
Motif group IL_53581.1
Basepair signature:
|
0.00 | -1852.90 | 19 | 19 |
Kink-turn related |
| 256 |
Motif group IL_29223.1
Basepair signature:
|
0.00 | -1921.50 | 9 | 7 |
|
| 257 |
Motif group IL_68405.1
Basepair signature:
|
0.00 | -1936.10 | 11 | 9 |
Kink-turn related |
| 258 |
Motif group IL_13874.1
Basepair signature:
|
0.00 | -1967.66 | 10 | 10 |
|
| 259 |
Motif group IL_03350.1
Basepair signature:
|
0.00 | -1981.00 | 12 | 9 |
Reverse kink-turn related |
| 260 |
Motif group IL_99692.2
Basepair signature:
|
0.00 | -1990.17 | 10 | 10 |
Kink-turn |
| 261 |
Motif group IL_55953.3
Basepair signature:
|
0.00 | -1996.97 | 10 | 8 |
|
| 262 |
Motif group IL_95727.1
Basepair signature:
|
0.00 | -2007.87 | 12 | 11 |
Kink-turn |
| 263 |
Motif group IL_73759.1
Basepair signature:
|
0.00 | -2022.72 | 8 | 7 |
Part of G-quadruplex |
| 264 |
Motif group IL_65594.1
Basepair signature:
|
0.00 | -2027.89 | 11 | 11 |
8x7 Sarcin-Ricin; G-bulge |
| 265 |
Motif group IL_02349.4
Basepair signature:
|
0.00 | -2028.63 | 11 | 10 |
8x6 Sarcin-Ricin with bulged A; G-bulge |
| 266 |
Motif group IL_04600.1
Basepair signature:
|
0.00 | -2028.76 | 12 | 10 |
|
| 267 |
Motif group IL_75283.2
Basepair signature:
|
0.00 | -2031.37 | 15 | 14 |
|
| 268 |
Motif group IL_04021.2
Basepair signature:
|
0.00 | -2032.99 | 10 | 10 |
Triple sheared with non-canonical cWW |
| 269 |
Motif group IL_89099.1
Basepair signature:
|
0.00 | -2033.51 | 10 | 8 |
Other IL |
| 270 |
Motif group IL_12745.1
Basepair signature:
|
0.00 | -2035.01 | 11 | 9 |
tWH-tWH-tHW-tHW |
| 271 |
Motif group IL_09044.1
Basepair signature:
|
0.00 | -2036.67 | 11 | 8 |
|
| 272 |
Motif group IL_24254.1
Basepair signature:
|
0.00 | -2051.15 | 10 | 9 |
7x6 Sarcin-Ricin with UU cWW pair; G-bulge |
| 273 |
Motif group IL_69986.1
Basepair signature:
|
0.00 | -2054.72 | 9 | 8 |
|
| 274 |
Motif group IL_04346.10
Basepair signature:
|
0.00 | -2061.90 | 11 | 11 |
8x7 Sarcin-Ricin; G-bulge |
| 275 |
Motif group IL_84409.1
Basepair signature:
|
0.00 | -2067.33 | 21 | 21 |
|
| 276 |
Motif group IL_80926.1
Basepair signature:
|
0.00 | -2078.08 | 8 | 8 |
|
| 277 |
Motif group IL_26728.3
Basepair signature:
|
0.00 | -2082.95 | 6 | 5 |
|
| 278 |
Motif group IL_59724.1
Basepair signature:
|
0.00 | -2098.46 | 12 | 11 |
8x7 Sarcin-Ricin with CC bifurcated pair; G-bulge |
| 279 |
Motif group IL_65851.3
Basepair signature:
|
0.00 | -2100.60 | 11 | 10 |
|
| 280 |
Motif group IL_61242.1
Basepair signature:
|
0.00 | -2100.65 | 7.5 | 6 |
|
| 281 |
Motif group IL_94910.1
Basepair signature:
|
0.00 | -2109.84 | 9 | 9 |
Kink-turn |
| 282 |
Motif group IL_56455.6
Basepair signature:
|
0.00 | -2113.65 | 14 | 14 |
Bacterial 5S Loop E |
| 283 |
Motif group IL_77045.1
Basepair signature:
|
0.00 | -2118.22 | 10 | 9 |
Kink-turn |
| 284 |
Motif group IL_80604.6
Basepair signature:
|
0.00 | -2120.25 | 13 | 11 |
|
| 285 |
Motif group IL_52743.1
Basepair signature:
|
0.00 | -2121.72 | 8 | 6 |
|
| 286 |
Motif group IL_32016.1
Basepair signature:
|
0.00 | -2125.88 | 11 | 9 |
Kink-turn |
| 287 |
Motif group IL_19048.1
Basepair signature:
|
0.00 | -2129.11 | 11 | 11 |
|
| 288 |
Motif group IL_06691.1
Basepair signature:
|
0.00 | -2129.83 | 9 | 7 |
|
| 289 |
Motif group IL_57188.5
Basepair signature:
|
0.00 | -2147.38 | 9 | 8 |
Kink-turn related |
| 290 |
Motif group IL_86012.1
Basepair signature:
|
0.00 | -2147.65 | 12 | 12 |
|
| 291 |
Motif group IL_28026.3
Basepair signature:
|
0.00 | -2149.65 | 12 | 11 |
|
| 292 |
Motif group IL_70096.1
Basepair signature:
|
0.00 | -2157.68 | 8 | 6 |
Kink-turn related |
| 293 |
Motif group IL_47346.2
Basepair signature:
|
0.00 | -2160.72 | 10 | 9 |
tSH-tSH-tHH-tHS |
| 294 |
Motif group IL_17069.5
Basepair signature:
|
0.00 | -2161.57 | 13 | 12 |
Kink-turn related |
| 295 |
Motif group IL_97631.1
Basepair signature:
|
0.00 | -2187.63 | 8 | 7 |
Triple sheared related |
| 296 |
Motif group IL_96788.1
Basepair signature:
|
0.00 | -2191.53 | 8 | 6 |
|
| 297 |
Motif group IL_26307.2
Basepair signature:
|
0.00 | -2198.01 | 9 | 9 |
7x6 Sarcin-Ricin; G-bulge |
| 298 |
Motif group IL_85879.1
Basepair signature:
|
0.00 | -2202.87 | 14 | 14 |
|
| 299 |
Motif group IL_01038.1
Basepair signature:
|
0.00 | -2217.22 | 9 | 7 |
UAA/GAN with extra stack |
| 300 |
Motif group IL_69543.3
Basepair signature:
|
0.00 | -2220.80 | 11 | 10 |
|
| 301 |
Motif group IL_71294.3
Basepair signature:
|
0.00 | -2220.89 | 9 | 8 |
Double sheared; A in syn; two near cWW pairs |
| 302 |
Motif group IL_00555.1
Basepair signature:
|
0.00 | -2225.09 | 9 | 7 |
|
| 303 |
Motif group IL_46174.3
Basepair signature:
|
0.00 | -2225.99 | 10 | 10 |
Kink-turn with non-sequential stacking |
| 304 |
Motif group IL_34822.1
Basepair signature:
|
0.00 | -2230.52 | 10 | 8 |
|
| 305 |
Motif group IL_88269.4
Basepair signature:
|
0.00 | -2232.28 | 8 | 7 |
6x5 Sarcin-Ricin; G-bulge |
| 306 |
Motif group IL_37015.1
Basepair signature:
|
0.00 | -2233.17 | 12 | 10 |
Kink-turn |
| 307 |
Motif group IL_60797.1
Basepair signature:
|
0.00 | -2263.30 | 17 | 16 |
|
| 308 |
Motif group IL_00981.1
Basepair signature:
|
0.00 | -2267.36 | 9 | 7 |
UAA/GAN with tHH |
| 309 |
Motif group IL_01488.3
Basepair signature:
|
0.00 | -2270.80 | 9 | 9 |
Kink-turn |
| 310 |
Motif group IL_07469.2
Basepair signature:
|
0.00 | -2278.40 | 8 | 6 |
|
| 311 |
Motif group IL_17765.1
Basepair signature:
|
0.00 | -2280.35 | 12 | 11 |
|
| 312 |
Motif group IL_44624.1
Basepair signature:
|
0.00 | -2283.50 | 12 | 11 |
|
| 313 |
Motif group IL_76308.6
Basepair signature:
|
0.00 | -2290.55 | 8 | 8 |
tSH-tWH-tHS-cWW |
| 314 |
Motif group IL_80231.1
Basepair signature:
|
0.00 | -2316.94 | 8 | 7 |
Other IL |
| 315 |
Motif group IL_81516.2
Basepair signature:
|
0.00 | -2359.69 | 16 | 14 |
|
| 316 |
Motif group IL_67767.4
Basepair signature:
|
0.00 | -2391.61 | 7 | 5 |
Receptor of 11-nt loop-receptor motif |
| 317 |
Motif group IL_42032.1
Basepair signature:
|
0.00 | -2407.70 | 10 | 7 |
|
| 318 |
Motif group IL_87284.1
Basepair signature:
|
0.00 | -2408.66 | 10 | 8 |
tSH-tHW-tWH-tHS |
| 319 |
Motif group IL_53448.1
Basepair signature:
|
0.00 | -2441.92 | 7 | 5 |
Receptor of 11-nt loop-receptor motif |
| 320 |
Motif group IL_12697.1
Basepair signature:
|
0.00 | -2474.77 | 9 | 7 |
|
| 321 |
Motif group IL_65718.4
Basepair signature:
|
0.00 | -2485.87 | 7 | 5 |
|
| 322 |
Motif group IL_91920.1
Basepair signature:
|
0.00 | -2494.45 | 7 | 5 |
|
| 323 |
Motif group IL_49767.8
Basepair signature:
|
0.00 | -2501.91 | 9 | 8 |
UAA/GAN with extra cWW |
| 324 |
Motif group IL_63519.1
Basepair signature:
|
0.00 | -2517.59 | 8 | 6 |
|
| 325 |
Motif group IL_96236.1
Basepair signature:
|
0.00 | -2529.59 | 9 | 6 |
|
| 326 |
Motif group IL_85536.2
Basepair signature:
|
0.00 | -2537.98 | 8 | 8 |
|
| 327 |
Motif group IL_62654.1
Basepair signature:
|
0.00 | -2622.38 | 8.5 | 7 |
tSH-tHH-tHS |
| 328 |
Motif group IL_97273.1
Basepair signature:
|
0.00 | -2652.11 | 7 | 5 |
|
| 329 |
Motif group IL_06136.2
Basepair signature:
|
0.00 | -2707.05 | 9 | 8 |
Quadruple sheared |
| 330 |
Motif group IL_94684.1
Basepair signature:
|
0.00 | -2720.09 | 6 | 5 |
|
| 331 |
Motif group IL_76319.5
Basepair signature:
|
0.00 | -2729.65 | 6 | 4 |
|
| 332 |
Motif group IL_22373.1
Basepair signature:
|
0.00 | -2804.84 | 6.5 | 4 |
8-nt loop receptor |
| 333 |
Motif group IL_25573.1
Basepair signature:
|
0.00 | -2827.37 | 8 | 5 |
|
| 334 |
Motif group IL_01994.1
Basepair signature:
|
0.00 | -2830.84 | 6 | 4 |
|
| 335 |
Motif group IL_24134.1
Basepair signature:
|
0.00 | -2832.82 | 10 | 8 |
Kink-turn |
| 336 |
Motif group IL_58103.11
Basepair signature:
|
0.00 | -2928.08 | 9 | 6 |
Symmetric double minor groove platform |
| 337 |
Motif group IL_61440.1
Basepair signature:
|
0.00 | -2966.33 | 8 | 6 |
Triple sheared |
| 338 |
Motif group IL_38634.5
Basepair signature:
|
0.00 | -2991.49 | 8 | 6 |
cWH basepair and non-canonical AC |
| 339 |
Motif group IL_28564.1
Basepair signature:
|
0.00 | -3007.27 | 7 | 4 |
|
| 340 |
Motif group IL_42314.1
Basepair signature:
|
0.00 | -3025.88 | 6.5 | 4 |
|
| 341 |
Motif group IL_13404.2
Basepair signature:
|
0.00 | -3028.58 | 6 | 4 |
Tandem non-canonical cWW pairs |
| 342 |
Motif group IL_96759.1
Basepair signature:
|
0.00 | -3034.44 | 7 | 4 |
|
| 343 |
Motif group IL_95570.1
Basepair signature:
|
0.00 | -3036.19 | 6 | 4 |
|
| 344 |
Motif group IL_33323.1
Basepair signature:
|
0.00 | -3039.65 | 7 | 5 |
|
| 345 |
Motif group IL_38507.2
Basepair signature:
|
0.00 | -3082.68 | 7 | 5 |
UAA/GAN |
| 346 |
Motif group IL_61299.4
Basepair signature:
|
0.00 | -3091.66 | 6.5 | 5 |
|
| 347 |
Motif group IL_68574.4
Basepair signature:
|
0.00 | -3107.76 | 6 | 5 |
|
| 348 |
Motif group IL_78800.1
Basepair signature:
|
0.00 | -3165.60 | 8 | 4 |
|
| 349 |
Motif group IL_69440.3
Basepair signature:
|
0.00 | -3202.29 | 7 | 4 |
|
| 350 |
Motif group IL_10484.1
Basepair signature:
|
0.00 | -3233.52 | 6 | 4 |
Double sheared |
| 351 |
Motif group IL_66997.2
Basepair signature:
|
0.00 | -3253.05 | 6 | 4 |
|
| 352 |
Motif group IL_02203.1
Basepair signature:
|
0.00 | -3256.57 | 6 | 4 |
|
| 353 |
Motif group IL_43644.1
Basepair signature:
|
0.00 | -3263.96 | 6 | 4 |
Other IL |
| 354 |
Motif group IL_17948.2
Basepair signature:
|
0.00 | -3290.41 | 6 | 6 |
Double sheared with non-canonical cWW |
| 355 |
Motif group IL_28788.1
Basepair signature:
|
0.00 | -3298.69 | 7 | 4 |
|
| 356 |
Motif group IL_44325.1
Basepair signature:
|
0.00 | -3353.46 | 6 | 4 |
|
| 357 |
Motif group IL_17136.7
Basepair signature:
|
0.00 | -3358.37 | 7 | 6 |
tSH-tWH-tHS |
| 358 |
Motif group IL_38862.4
Basepair signature:
|
0.00 | -3366.94 | 7 | 6 |
5x5 Sarcin-Ricin with intercalated A; G-bulge |
| 359 |
Motif group IL_19102.1
Basepair signature:
|
0.00 | -3414.48 | 6 | 4 |
|
| 360 |
Motif group IL_57881.1
Basepair signature:
|
0.00 | -3459.14 | 8 | 4 |
Multiple bulged bases |
| 361 |
Motif group IL_61438.4
Basepair signature:
|
0.00 | -3475.30 | 6 | 3 |
|
| 362 |
Motif group IL_15698.3
Basepair signature:
|
0.00 | -3498.08 | 5 | 3 |
|
| 363 |
Motif group IL_04785.1
Basepair signature:
|
0.00 | -3521.13 | 6 | 4 |
|
| 364 |
Motif group IL_99646.2
Basepair signature:
|
0.00 | -3521.93 | 6 | 5 |
tSH-tHW |
| 365 |
Motif group IL_49751.4
Basepair signature:
|
0.00 | -3567.38 | 7 | 6 |
Triple non-canonical cWW pairs |
| 366 |
Motif group IL_68909.1
Basepair signature:
|
0.00 | -3587.30 | 6 | 5 |
|
| 367 |
Motif group IL_80398.1
Basepair signature:
|
0.00 | -3591.32 | 7 | 4 |
Minor groove platform |
| 368 |
Motif group IL_50730.2
Basepair signature:
|
0.00 | -3627.39 | 6 | 6 |
Triple sheared |
| 369 |
Motif group IL_84251.1
Basepair signature:
|
0.00 | -3628.69 | 7 | 4 |
|
| 370 |
Motif group IL_08770.1
Basepair signature:
|
0.00 | -3705.45 | 4 | 2 |
|
| 371 |
Motif group IL_77658.1
Basepair signature:
|
0.00 | -3725.54 | 5 | 4 |
Tandem non-canonical cWW pairs |
| 372 |
Motif group IL_06549.2
Basepair signature:
|
0.00 | -3739.87 | 7 | 4 |
|
| 373 |
Motif group IL_56987.1
Basepair signature:
|
0.00 | -3767.06 | 4 | 2 |
|
| 374 |
Motif group IL_61341.1
Basepair signature:
|
0.00 | -3773.95 | 5.5 | 3 |
|
| 375 |
Motif group IL_55516.2
Basepair signature:
|
0.00 | -3792.78 | 4 | 3 |
|
| 376 |
Motif group IL_15052.4
Basepair signature:
|
0.00 | -3817.95 | 3 | 2 |
Minor groove platform |
| 377 |
Motif group IL_68140.4
Basepair signature:
|
0.00 | -3845.68 | 3 | 2 |
Major groove minor groove platform; mini C-loop |
| 378 |
Motif group IL_41344.1
Basepair signature:
|
0.00 | -3874.16 | 5 | 3 |
|
| 379 |
Motif group IL_77691.5
Basepair signature:
|
0.00 | -3879.53 | 6 | 5 |
UAA/GAN related |
| 380 |
Motif group IL_09990.4
Basepair signature:
|
0.00 | -3891.62 | 5 | 3 |
|
| 381 |
Motif group IL_07785.1
Basepair signature:
|
0.00 | -3900.85 | 3 | 2 |
Isolated non-canonical cWW pair |
| 382 |
Motif group IL_14688.1
Basepair signature:
|
0.00 | -3908.59 | 4 | 2 |
Isolated non-canonical cWW pair |
| 383 |
Motif group IL_02555.1
Basepair signature:
|
0.00 | -3910.56 | 4 | 2 |
Major groove platform with intercalation |
| 384 |
Motif group IL_96371.1
Basepair signature:
|
0.00 | -3912.41 | 5 | 3 |
|
| 385 |
Motif group IL_87907.2
Basepair signature:
|
0.00 | -3917.11 | 2 | 2 |
Isolated non-canonical cWW pair |
| 386 |
Motif group IL_67095.2
Basepair signature:
|
0.00 | -3918.81 | 4 | 2 |
Isolated tWW turn |
| 387 |
Motif group IL_10167.6
Basepair signature:
|
0.00 | -3926.24 | 3 | 2 |
Isolated cWH basepair |
| 388 |
Motif group IL_85599.2
Basepair signature:
|
0.00 | -3927.56 | 4 | 2 |
Isolated tHS basepair with bulges |
| 389 |
Motif group IL_57744.1
Basepair signature:
|
0.00 | -3927.83 | 3 | 2 |
Isolated non-canonical cWW pair |
| 390 |
Motif group IL_58112.2
Basepair signature:
|
0.00 | -3928.01 | 7 | 5 |
|
| 391 |
Motif group IL_42997.3
Basepair signature:
|
0.00 | -3929.46 | 3 | 2 |
Isolated cWS basepair |
| 392 |
Motif group IL_10796.1
Basepair signature:
|
0.00 | -3934.12 | 5 | 2 |
|
| 393 |
Motif group IL_83389.2
Basepair signature:
|
0.00 | -3943.23 | 6 | 3 |
|
| 394 |
Motif group IL_28037.2
Basepair signature:
|
0.00 | -3947.07 | 3 | 2 |
Isolated non-canonical cWW pair |
| 395 |
Motif group IL_51479.1
Basepair signature:
|
0.00 | -3951.36 | 5 | 4 |
|
| 396 |
Motif group IL_23774.1
Basepair signature:
|
0.00 | -4001.50 | 6 | 5 |
UAA/GAN variation |
| 397 |
Motif group IL_36516.3
Basepair signature:
|
0.00 | -4018.32 | 5 | 4 |
|
| 398 |
Motif group IL_85033.2
Basepair signature:
|
0.00 | -4047.15 | 5 | 4 |
Tandem non-canonical cWW pairs |
| 399 |
Motif group IL_50694.7
Basepair signature:
|
0.00 | -4048.49 | 4 | 2 |
Major groove platform; stack outside cWW |
| 400 |
Motif group IL_47078.3
Basepair signature:
|
0.00 | -4048.53 | 6 | 3 |
Minor groove platform |
| 401 |
Motif group IL_25872.4
Basepair signature:
|
0.00 | -4063.08 | 6 | 4 |
|
| 402 |
Motif group IL_09705.15
Basepair signature:
|
0.00 | -4066.07 | 4 | 4 |
Double sheared |
| 403 |
Motif group IL_22564.1
Basepair signature:
|
0.00 | -6273.57 | 11 | 9 |
|
| 404 |
Motif group IL_26222.2
Basepair signature:
|
0.00 | -7053.70 | 7 | 5 |
C-loop with bulged stacked A's |
| 405 |
Motif group IL_63596.11
Basepair signature:
|
0.00 | -8771.61 | 6 | 4 |
C-loop |
| 406 |
Motif group IL_59877.1
Basepair signature:
|
0.00 | -9853.07 | 5 | 2 |
|
| 407 |
Motif group IL_03109.3
Basepair signature:
|
0.00 | -9999.00 | 5 | 3 |
C-loop |
| 408 |
Motif group IL_20245.1
Basepair signature:
|
0.00 | -9999.00 | 23 | 21 |
|
| 409 |
Motif group IL_45896.1
Basepair signature:
|
0.00 | -9999.00 | 18 | 18 |
|
| 410 |
Motif group IL_54737.1
Basepair signature:
|
0.00 | -9999.00 | 24 | 23 |
|
| 411 |
Motif group IL_83150.2
Basepair signature:
|
0.00 | -9999.00 | 6 | 4 |
|