There are no chains in PDB that we map to Rfam family RF03125.

Rfam family RF03125 is part of clan CL00117, which includes Rfam families RF03121, RF03123, RF03125, RF03122, RF00164, RF03124, RF00165 .
There is 1 chain in PDB that we map to these Rfam families: 1XJR|1|A . See it at RNA 3D Hub by filtering on Rfam family, clan, or chain.

Loop 1 Internal loop

Column numbers: 14-218, 258-260
    Scored sequences and counts
UCAGGCCUAAACUCAUGCAGACCACACAAGGCAGAUGGGCUAUAUAAACGUUUUCGCUUUUCCGUUUACGAUAUAUAGUCUACUCUUGUGCAGAAUGAAUUCUCGUAACUACAUAGCACAAGUAGAUGUAGUUAACUUUAAUCUCACAUAGCAAUCUUUAAUCAGUGUGUAACAUUAGGGAGGACUUGAAAGAGCCACCACAUUU*ACA 2
AGGCAUAAACACUCAUGAUGACCACACAAGGCAGAUGGGCUAUGUAAACGUUUUCGCAAUUCCGUUUACGAUACAUAGUCUACUCUUGUGCAGAAUGAAUUCUCGUAACUAAACAGCACAAGUAGGUUUAGUUAACUUUAAUCUCACAUAGCAAUCUUUAAUCAAUGUGUAACAUUAGGGAGGACUUGAAAGAGCCACCACAUUU*AUA 1
---CAUAAACACUCAUGAUGACCACACAAGGCAGAUGGGCUAUGUAAACGUUUUCGCAAUUCCGUUUACGAUACAUAGUCUACUCUUGUGCAGAAUGAAUUCUCGUAACUAAACAGCACAAGUAGGUUUAGUUAACUUUAAUUUCACAUAGCAAUCUUUAAUAAAUGUGUAAUGUUAGGGAGGACUUGAAAGAGCCACCACAUUU*AUA 1
------------UCAUGAUGACCACACAAGGCAGAUGGGCUAUGUAAACGUCUUCGCAAUUCCGUUUACGAUACAUAGUCUACUCUUGUGCAGAAUGAAUUCUCGUAGCUAAACAGCACAAGUAGGUUUAGUUAACUUUAAUCUCACAUAGCAAUCUUUAAUCAAUGUGUAACAUUAGGGAGGACUUGAAAGAGCCACCACAUUU*AUA 1
------------UCAUGAUGACCACACAAGGCAGAUGGGCUAUGUAAACGUUUUCGCAAUUCCGUUUACGAUACAUAGUCUACUCUUGUGCAGAAUGAAUUCUCGUAACUAAACAGCACAAGUAGGUUUAGUUAACUUUAAUCUCACAUAGCAAUCUUUAAUCAAUGUGUAACAUUAGGGAGGACUUGAGAGAGCCACCACAUUU*AUA 1
------------UCAUGAUGACCACACAAGGCAGAUGGGCUAUGUAAACGUUUUCGCAAUUCCGUUUACGAUACAUAGUCUACUCUUGUGCAGAAUGAAUUCUCGUAACUAAACAGCACAAGUAGGUUUAGUUAACUUUAAUUUCACAUAGCAAUCUUCAAUCAAUGUGUAACAUUAGGGAGGACUUAAAAGAGCCACCACACUU*AUA 1
----------------GAUGACCACACAAGGCAGAUGGGCUAUGUAAACGUUUUCGCAAUUCCGUUUACGAUACAUAGUCUACUCUUGCGUAGAAUGAGUUCUCGUAGCUAAACAGCACAAGUAGGUUUAGUUAACUUUAAUCUCACAUAGCAAUCUUUAAUCAAUGUGUAACAUUAGGGAGGACUUGAAAGAGCCACCACAUUU*AUA 1
------------------UGACCACACAAGGCAGAUGGGCUAUGUAAACGUUUUCGCUAUUCCGUUUACGAUACAUAGUCUACUCUUGUGCAGAAUGAAUUCUCGUAGCUAAACAGCACAAGUAGGUUUAGUUAACUUUAAUCUCACAUAGCAAUCUUUAAUCAAUGUGUAACAUUAGGGAGGACUGGAAAGAGCCACCACAUAG*CUA 1
-------------------GACCACACAAGGCAGAUGGGCUAUAUAAACGUUUUCGCUUUUCCGUUUACGAUAUAUAGUCUACUCUUGUGCAGAAUGAAUUCUCGUAACUACAUAGCACAAGUAGAUGUAGUUAACUUUAAUCUCACAUAGCAAUCUUUAAUCAGUGUGUAACAUUAGGGAGGACUUGAAAGAGCCACCACAUUU*ACA 1
--------------------ACCACACAAGGCAGAUGGGCUAUGUAAACGUUUUCGCAAUUCCGUUUACGAUACAUAGUCUACUCUUGUGCAGAAUGAAUUCUCGUAGCUAAACAGCACAAGUAGGUUUAGUUAACUUUAAUCUCACAUAGCAAUCUUUAAUCAAUGUGUAACAUUAGGGAGGACUUGAAAGAGCCACCACAUUU*AUA 1
Click on headings to reorder table
# Matching motif group Acceptance Rate Mean Cutoff Score Full Edit Distance Interior Edit Distance Basepair Diagram and most common annotation
1 0.00 -9999.00 188 188

Kink-turn

2 0.00 -9999.00 192 192

tSH-tHW

3 0.00 -9999.00 192 192

4 0.00 -9999.00 191 190

5 0.00 -9999.00 189 189

6 0.00 -9999.00 189 189

7 0.00 -9999.00 188 188

Reverse turn

8 0.00 -9999.00 189 188

9 0.00 -9999.00 190 191

Triple sheared related

10 0.00 -9999.00 191 191

11 0.00 -9999.00 191 191

12 0.00 -9999.00 194 193

13 0.00 -9999.00 182 181

14 0.00 -9999.00 189 189

15 0.00 -9999.00 191 191

16 0.00 -9999.00 188 187

Vitamin B12 Aptamer

17 0.00 -9999.00 187 188

Kink-turn

18 0.00 -9999.00 190 189

19 0.00 -9999.00 191 190

Minor groove platform, major groove intercalation

20 0.00 -9999.00 191 190

21 0.00 -9999.00 188 188

Kink-turn

22 0.00 -9999.00 188 188

23 0.00 -9999.00 192 191

24 0.00 -9999.00 189 190

25 0.00 -9999.00 188 189

26 0.00 -9999.00 191 191

27 0.00 -9999.00 190 190

28 0.00 -9999.00 189 188

29 0.00 -9999.00 190 191

30 0.00 -9999.00 189 188

31 0.00 -9999.00 190 191

Single stack bend

32 0.00 -9999.00 190 190

33 0.00 -9999.00 189 189

34 0.00 -9999.00 190 190

35 0.00 -9999.00 191 192

Single bulged U

36 0.00 -9999.00 187 187

37 0.00 -9999.00 192 192

Other IL

38 0.00 -9999.00 191 191

UAA/GAN

39 0.00 -9999.00 188 188

40 0.00 -9999.00 185 185

41 0.00 -9999.00 191 192

42 0.00 -9999.00 189 190

6x5 Sarcin-Ricin; G-bulge

43 0.00 -9999.00 189 188

44 0.00 -9999.00 186 185

45 0.00 -9999.00 189 188

46 0.00 -9999.00 191 191

Isolated non-canonical cWW pair

47 0.00 -9999.00 182 182

Kink-turn related

48 0.00 -9999.00 191 192

tSH-tHW-tWH-tHS

49 0.00 -9999.00 189 189

50 0.00 -9999.00 188 187

51 0.00 -9999.00 189 189

52 0.00 -9999.00 188 189

53 0.00 -9999.00 189 190

54 0.00 -9999.00 187 188

55 0.00 -9999.00 192 192

Isolated tHS basepair with bulges

56 0.00 -9999.00 190 191

57 0.00 -9999.00 186 185

58 0.00 -9999.00 190 189

59 0.00 -9999.00 191 191

Tandem non-canonical cWW pairs

60 0.00 -9999.00 191 192

tSH-tHW-tHH-tHS

61 0.00 -9999.00 184 183

62 0.00 -9999.00 191 190

Multiple bulged bases

63 0.00 -9999.00 193 192

64 0.00 -9999.00 187 188

65 0.00 -9999.00 192 192

66 0.00 -9999.00 190 190

67 0.00 -9999.00 187 188

68 0.00 -9999.00 190 189

69 0.00 -9999.00 187 186

70 0.00 -9999.00 188 188

71 0.00 -9999.00 187 186

72 0.00 -9999.00 189 190

73 0.00 -9999.00 190 191

74 0.00 -9999.00 191 191

Multiple bulged bases

75 0.00 -9999.00 191 191

Intercalated cWS

76 0.00 -9999.00 184 185

77 0.00 -9999.00 191 190

Major groove minor groove platform with intercalation; mini C-loop

78 0.00 -9999.00 182 182

79 0.00 -9999.00 191 191

80 0.00 -9999.00 191 191

81 0.00 -9999.00 188 188

82 0.00 -9999.00 191 192

83 0.00 -9999.00 192 192

Minor groove platform

84 0.00 -9999.00 190 190

Other IL

85 0.00 -9999.00 172 173

86 0.00 -9999.00 184 184

87 0.00 -9999.00 191 191

88 0.00 -9999.00 179 179

89 0.00 -9999.00 190 191

90 0.00 -9999.00 190 189

91 0.00 -9999.00 189 189

92 0.00 -9999.00 188 188

93 0.00 -9999.00 190 190

UAA/GAN related

94 0.00 -9999.00 190 190

Tandem non-canonical cWW pairs

95 0.00 -9999.00 188 189

Kink-turn

96 0.00 -9999.00 189 189

97 0.00 -9999.00 190 189

Intercalated tWH

98 0.00 -9999.00 180 179

99 0.00 -9999.00 191 191

100 0.00 -9999.00 189 189

101 0.00 -9999.00 191 191

tSH-tWH-tHS-cWW

102 0.00 -9999.00 190 190

103 0.00 -9999.00 186 186

cWH basepair with bulged bases

104 0.00 -9999.00 182 182

105 0.00 -9999.00 190 190

106 0.00 -9999.00 187 186

107 0.00 -9999.00 190 191

108 0.00 -9999.00 188 188

Kink-turn

109 0.00 -9999.00 190 189

110 0.00 -9999.00 191 190

Part of G-quadruplex

111 0.00 -9999.00 191 190

112 0.00 -9999.00 187 188

113 0.00 -9999.00 188 187

114 0.00 -9999.00 192 191

115 0.00 -9999.00 191 191

116 0.00 -9999.00 191 192

Double sheared; A in syn; two near cWW pairs

117 0.00 -9999.00 188 189

Kink-turn

118 0.00 -9999.00 191 191

119 0.00 -9999.00 191 192

9x9 Sarcin-Ricin with pseudoknotted region; G-bulge

120 0.00 -9999.00 190 190

121 0.00 -9999.00 189 189

UAA/GAN related

122 0.00 -9999.00 189 189

123 0.00 -9999.00 190 191

124 0.00 -9999.00 190 191

125 0.00 -9999.00 193 193

Kink-turn related

126 0.00 -9999.00 191 191

127 0.00 -9999.00 190 190

128 0.00 -9999.00 184 184

129 0.00 -9999.00 188 188

Kink-turn

130 0.00 -9999.00 190 189

131 0.00 -9999.00 189 190

Pseudoknot

132 0.00 -9999.00 190 190

133 0.00 -9999.00 192 192

134 0.00 -9999.00 191 191

135 0.00 -9999.00 190 190

Kink-turn related

136 0.00 -9999.00 190 190

Major groove minor groove platform; mini C-loop

137 0.00 -9999.00 190 190

Receptor of 11-nt loop-receptor motif

138 0.00 -9999.00 191 192

139 0.00 -9999.00 188 189

Minor groove platform related

140 0.00 -9999.00 192 192

Isolated tWW turn

141 0.00 -9999.00 190 190

142 0.00 -9999.00 191 192

AAA cross-strand stack

143 0.00 -9999.00 190 190

Major groove intercalation

144 0.00 -9999.00 189 189

145 0.00 -9999.00 191 192

146 0.00 -9999.00 192 191

147 0.00 -9999.00 191 191

8x7 Sarcin-Ricin; G-bulge

148 0.00 -9999.00 185 186

149 0.00 -9999.00 187 188

Kink-turn

150 0.00 -9999.00 188 188

151 0.00 -9999.00 188 187

152 0.00 -9999.00 185 186

153 0.00 -9999.00 190 190

154 0.00 -9999.00 185 185

155 0.00 -9999.00 193 192

156 0.00 -9999.00 189 189

C-loop

157 0.00 -9999.00 192 192

158 0.00 -9999.00 191 192

tSH-tHH-tHS

159 0.00 -9999.00 192 191

Decoding loop related

160 0.00 -9999.00 190 190

161 0.00 -9999.00 192 191

162 0.00 -9999.00 192 192

Triple sheared

163 0.00 -9999.00 191 190

164 0.00 -9999.00 189 188

165 0.00 -9999.00 190 190

8x6 Sarcin-Ricin with inserted A; G-bulge

166 0.00 -9999.00 191 192

Single bulged C

167 0.00 -9999.00 190 191

168 0.00 -9999.00 192 191

169 0.00 -9999.00 184 183

170 0.00 -9999.00 192 193

171 0.00 -9999.00 186 186

172 0.00 -9999.00 191 191

8x7 Sarcin-Ricin with CC bifurcated pair; G-bulge

173 0.00 -9999.00 191 191

174 0.00 -9999.00 189 189

175 0.00 -9999.00 190 190

176 0.00 -9999.00 189 190

177 0.00 -9999.00 186 186

178 0.00 -9999.00 188 189

179 0.00 -9999.00 190 190

180 0.00 -9999.00 191 192

181 0.00 -9999.00 191 190

Multiple bulged bases

182 0.00 -9999.00 190 191

Symmetric double minor groove platform

183 0.00 -9999.00 191 191

Isolated non-canonical cWW pair

184 0.00 -9999.00 188 188

185 0.00 -9999.00 191 191

186 0.00 -9999.00 189 189

Kink-turn related

187 0.00 -9999.00 190 191

Bacterial 5S Loop E

188 0.00 -9999.00 191 190

189 0.00 -9999.00 191 191

190 0.00 -9999.00 186 186

191 0.00 -9999.00 189 189

192 0.00 -9999.00 182 182

193 0.00 -9999.00 186 185

194 0.00 -9999.00 192 193

195 0.00 -9999.00 185 185

196 0.00 -9999.00 188 188

tHW-tHW cross-strand stack

197 0.00 -9999.00 186 186

198 0.00 -9999.00 182 182

Pseudoknot

199 0.00 -9999.00 188 189

Kink-turn related

200 0.00 -9999.00 190 190

Receptor of 11-nt loop-receptor motif

201 0.00 -9999.00 188 188

202 0.00 -9999.00 190 191

Minor groove platform

203 0.00 -9999.00 191 191

204 0.00 -9999.00 188 189

205 0.00 -9999.00 189 189

Kink-turn from U4

206 0.00 -9999.00 188 188

207 0.00 -9999.00 181 182

208 0.00 -9999.00 191 192

Triple sheared

209 0.00 -9999.00 191 191

Major groove platform; stack outside cWW

210 0.00 -9999.00 187 186

211 0.00 -9999.00 191 190

212 0.00 -9999.00 191 191

UAA/GAN with extra cWW

213 0.00 -9999.00 191 191

Triple non-canonical cWW pairs

214 0.00 -9999.00 189 188

Major groove intercalation

215 0.00 -9999.00 189 188

216 0.00 -9999.00 189 188

217 0.00 -9999.00 191 192

218 0.00 -9999.00 191 191

Major groove platform

219 0.00 -9999.00 191 190

220 0.00 -9999.00 189 189

221 0.00 -9999.00 191 192

tSH-tSH-tHH-tHS

222 0.00 -9999.00 188 187

Kink-turn related

223 0.00 -9999.00 190 190

Minor groove platform

224 0.00 -9999.00 189 189

225 0.00 -9999.00 189 189

226 0.00 -9999.00 188 189

Kink-turn with non-sequential stacking

227 0.00 -9999.00 188 188

228 0.00 -9999.00 186 186

229 0.00 -9999.00 193 193

230 0.00 -9999.00 190 190

231 0.00 -9999.00 188 188

tSH-tHW

232 0.00 -9999.00 191 191

Isolated non-canonical cWW contact

233 0.00 -9999.00 185 184

234 0.00 -9999.00 190 191

235 0.00 -9999.00 191 190

236 0.00 -9999.00 189 190

237 0.00 -9999.00 191 191

Other IL

238 0.00 -9999.00 189 190

10x8 Sarcin-Ricin; G-bulge

239 0.00 -9999.00 188 188

240 0.00 -9999.00 188 189

Pseudoknot

241 0.00 -9999.00 186 185

242 0.00 -9999.00 190 191

Isolated cWS basepair

243 0.00 -9999.00 191 191

Multiple bulged bases

244 0.00 -9999.00 191 192

245 0.00 -9999.00 192 193

246 0.00 -9999.00 190 190

247 0.00 -9999.00 188 188

248 0.00 -9999.00 189 188

249 0.00 -9999.00 184 183

250 0.00 -9999.00 187 187

251 0.00 -9999.00 189 190

8x6 Sarcin-Ricin with inserted Y; G-bulge

252 0.00 -9999.00 191 191

253 0.00 -9999.00 186 187

SSU/LSU pseudoknot

254 0.00 -9999.00 187 186

Reverse kink-turn related

255 0.00 -9999.00 191 192

5x5 Sarcin-Ricin with intercalated A; G-bulge

256 0.00 -9999.00 191 191

cWH basepair and non-canonical AC

257 0.00 -9999.00 187 187

258 0.00 -9999.00 190 190

UAA/GAN

259 0.00 -9999.00 188 188

260 0.00 -9999.00 189 188

261 0.00 -9999.00 188 187

262 0.00 -9999.00 187 187

Kink-turn

263 0.00 -9999.00 190 190

264 0.00 -9999.00 192 192

265 0.00 -9999.00 190 190

266 0.00 -9999.00 175 175

267 0.00 -9999.00 190 190

268 0.00 -9999.00 190 191

9x8 Sarcin-Ricin with GA cWW pair; G-bulge

269 0.00 -9999.00 192 191

270 0.00 -9999.00 190 189

Kink-turn with embedded cWW pair

271 0.00 -9999.00 186 186

Minor groove platform

272 0.00 -9999.00 188 187

273 0.00 -9999.00 190 189

274 0.00 -9999.00 189 189

275 0.00 -9999.00 185 184

276 0.00 -9999.00 190 189

277 0.00 -9999.00 192 193

Kink-turn

278 0.00 -9999.00 192 191

Stack and bulge

279 0.00 -9999.00 190 191

280 0.00 -9999.00 192 191

281 0.00 -9999.00 192 191

Decoding loop related

282 0.00 -9999.00 191 192

Single bulged A

283 0.00 -9999.00 181 181

284 0.00 -9999.00 189 190

285 0.00 -9999.00 185 185

286 0.00 -9999.00 182 181

287 0.00 -9999.00 190 189

288 0.00 -9999.00 188 189

289 0.00 -9999.00 187 188

290 0.00 -9999.00 190 189

Left turn

291 0.00 -9999.00 189 190

292 0.00 -9999.00 190 191

7x7 Sarcin-Ricin with intercalated A; G-bulge

293 0.00 -9999.00 192 191

294 0.00 -9999.00 194 194

295 0.00 -9999.00 189 189

296 0.00 -9999.00 191 191

Isolated non-canonical cWW pair

297 0.00 -9999.00 190 190

298 0.00 -9999.00 188 187

299 0.00 -9999.00 191 192

Single stack bend

300 0.00 -9999.00 191 190

301 0.00 -9999.00 191 190

Multiple bulged bases

302 0.00 -9999.00 190 191

7x6 Sarcin-Ricin; G-bulge

303 0.00 -9999.00 187 187

304 0.00 -9999.00 189 190

C-loop with bulged stacked A's

305 0.00 -9999.00 192 192

306 0.00 -9999.00 190 189

307 0.00 -9999.00 189 189

308 0.00 -9999.00 189 188

Major groove intercalation

309 0.00 -9999.00 192 192

310 0.00 -9999.00 187 187

311 0.00 -9999.00 189 190

7x6 Sarcin-Ricin with UU cWW pair; G-bulge

312 0.00 -9999.00 188 188

Kink-turn

313 0.00 -9999.00 191 191

UAA/GAN variation

314 0.00 -9999.00 189 190

315 0.00 -9999.00 188 187

316 0.00 -9999.00 188 188

317 0.00 -9999.00 189 189

318 0.00 -9999.00 190 190

319 0.00 -9999.00 190 189

8-nt loop receptor

320 0.00 -9999.00 190 191

321 0.00 -9999.00 190 190

322 0.00 -9999.00 189 189

tSH-tHW

323 0.00 -9999.00 187 186

324 0.00 -9999.00 186 187

7x11 Sarcin-Ricin with pseudoknotted region; G-bulge

325 0.00 -9999.00 190 191

326 0.00 -9999.00 182 182

327 0.00 -9999.00 189 189

328 0.00 -9999.00 190 190

329 0.00 -9999.00 186 186

330 0.00 -9999.00 189 189

Isolated non-canonical cWW pair

331 0.00 -9999.00 183 184

Part of G-quadruplex

332 0.00 -9999.00 183 183

Pseudoknot

333 0.00 -9999.00 190 190

334 0.00 -9999.00 190 190

335 0.00 -9999.00 190 190

336 0.00 -9999.00 190 191

337 0.00 -9999.00 184 184

338 0.00 -9999.00 191 192

Double sheared with non-canonical cWW

339 0.00 -9999.00 181 180

340 0.00 -9999.00 185 184

341 0.00 -9999.00 189 189

Kink-turn related

342 0.00 -9999.00 191 191

tSH-tWH-tHS

343 0.00 -9999.00 187 187

344 0.00 -9999.00 191 191

Sarcin-Ricin target in LSU H95; G-bulge

345 0.00 -9999.00 193 192

346 0.00 -9999.00 192 191

347 0.00 -9999.00 187 186

348 0.00 -9999.00 189 189

349 0.00 -9999.00 185 184

350 0.00 -9999.00 187 188

351 0.00 -9999.00 190 190

Minor groove platform

352 0.00 -9999.00 191 191

Isolated non-canonical cWW pair

353 0.00 -9999.00 189 189

354 0.00 -9999.00 190 190

Major groove platform with intercalated tWH

355 0.00 -9999.00 190 189

356 0.00 -9999.00 180 180

357 0.00 -9999.00 191 191

Tandem non-canonical cWW pairs

358 0.00 -9999.00 189 188

359 0.00 -9999.00 192 192

tWH-tWH-tHW-tHW

360 0.00 -9999.00 189 188

361 0.00 -9999.00 192 193

362 0.00 -9999.00 190 190

363 0.00 -9999.00 192 191

364 0.00 -9999.00 189 189

180 degree turn

365 0.00 -9999.00 193 192

366 0.00 -9999.00 192 192

367 0.00 -9999.00 192 191

Isolated cWH basepair

368 0.00 -9999.00 191 191

Double sheared

369 0.00 -9999.00 190 189

370 0.00 -9999.00 191 191

371 0.00 -9999.00 189 189

Reverse kink-turn

372 0.00 -9999.00 190 190

Double sheared

373 0.00 -9999.00 188 188

374 0.00 -9999.00 190 191

375 0.00 -9999.00 192 191

376 0.00 -9999.00 190 190

377 0.00 -9999.00 190 189

Isolated non-canonical cWW pair

378 0.00 -9999.00 188 189

379 0.00 -9999.00 190 190

Bulged stacked bases

380 0.00 -9999.00 190 189

381 0.00 -9999.00 192 192

Major groove platform

382 0.00 -9999.00 193 193

383 0.00 -9999.00 189 190

384 0.00 -9999.00 190 190

385 0.00 -9999.00 191 191

Quadruple sheared

386 0.00 -9999.00 182 182

Kink-turn

387 0.00 -9999.00 190 190

388 0.00 -9999.00 188 187

389 0.00 -9999.00 193 192

390 0.00 -9999.00 190 191

391 0.00 -9999.00 185 185

392 0.00 -9999.00 187 187

tSH-tHS-tHW

393 0.00 -9999.00 191 192

394 0.00 -9999.00 189 190

8x7 Sarcin-Ricin; G-bulge

395 0.00 -9999.00 184 183

396 0.00 -9999.00 187 187

397 0.00 -9999.00 189 189

398 0.00 -9999.00 190 191

Triple sheared with non-canonical cWW

399 0.00 -9999.00 187 187

Reverse kink-turn related

400 0.00 -9999.00 189 190

C-loop

401 0.00 -9999.00 190 191

Major groove platform with intercalation

402 0.00 -9999.00 189 190

8x6 Sarcin-Ricin with bulged A; G-bulge

403 0.00 -9999.00 192 191

404 0.00 -9999.00 188 188

Kink-turn

405 0.00 -9999.00 190 189

406 0.00 -9999.00 190 191

407 0.00 -9999.00 192 193

UAA/GAN with extra stack

408 0.00 -9999.00 192 193

UAA/GAN with tHH

409 0.00 -9999.00 190 190

410 0.00 -9999.00 190 189

411 0.00 -9999.00 191 192

Single bulged G

Coloring options: