JAR3D
Query RF03125-CCF-3.98 completed
Run on Motif Atlas Version
using the Rfam secondary structure. Run with the CaCoFold secondary structure.
There are no chains in PDB that we map to Rfam family RF03125.
Rfam family RF03125
is part of clan CL00117, which includes Rfam families
RF03121,
RF03123,
RF03125,
RF03122,
RF00164,
RF03124,
RF00165
.
There is 1 chain in PDB that we map to these Rfam families:
1XJR|1|A
.
See it at RNA 3D Hub
by filtering on Rfam family, clan, or chain.
Loop 1 Internal loop
Column numbers: 14-218, 258-260
Scored sequences and counts
UCAGGCCUAAACUCAUGCAGACCACACAAGGCAGAUGGGCUAUAUAAACGUUUUCGCUUUUCCGUUUACGAUAUAUAGUCUACUCUUGUGCAGAAUGAAUUCUCGUAACUACAUAGCACAAGUAGAUGUAGUUAACUUUAAUCUCACAUAGCAAUCUUUAAUCAGUGUGUAACAUUAGGGAGGACUUGAAAGAGCCACCACAUUU*ACA 2
AGGCAUAAACACUCAUGAUGACCACACAAGGCAGAUGGGCUAUGUAAACGUUUUCGCAAUUCCGUUUACGAUACAUAGUCUACUCUUGUGCAGAAUGAAUUCUCGUAACUAAACAGCACAAGUAGGUUUAGUUAACUUUAAUCUCACAUAGCAAUCUUUAAUCAAUGUGUAACAUUAGGGAGGACUUGAAAGAGCCACCACAUUU*AUA 1
---CAUAAACACUCAUGAUGACCACACAAGGCAGAUGGGCUAUGUAAACGUUUUCGCAAUUCCGUUUACGAUACAUAGUCUACUCUUGUGCAGAAUGAAUUCUCGUAACUAAACAGCACAAGUAGGUUUAGUUAACUUUAAUUUCACAUAGCAAUCUUUAAUAAAUGUGUAAUGUUAGGGAGGACUUGAAAGAGCCACCACAUUU*AUA 1
------------UCAUGAUGACCACACAAGGCAGAUGGGCUAUGUAAACGUCUUCGCAAUUCCGUUUACGAUACAUAGUCUACUCUUGUGCAGAAUGAAUUCUCGUAGCUAAACAGCACAAGUAGGUUUAGUUAACUUUAAUCUCACAUAGCAAUCUUUAAUCAAUGUGUAACAUUAGGGAGGACUUGAAAGAGCCACCACAUUU*AUA 1
------------UCAUGAUGACCACACAAGGCAGAUGGGCUAUGUAAACGUUUUCGCAAUUCCGUUUACGAUACAUAGUCUACUCUUGUGCAGAAUGAAUUCUCGUAACUAAACAGCACAAGUAGGUUUAGUUAACUUUAAUCUCACAUAGCAAUCUUUAAUCAAUGUGUAACAUUAGGGAGGACUUGAGAGAGCCACCACAUUU*AUA 1
------------UCAUGAUGACCACACAAGGCAGAUGGGCUAUGUAAACGUUUUCGCAAUUCCGUUUACGAUACAUAGUCUACUCUUGUGCAGAAUGAAUUCUCGUAACUAAACAGCACAAGUAGGUUUAGUUAACUUUAAUUUCACAUAGCAAUCUUCAAUCAAUGUGUAACAUUAGGGAGGACUUAAAAGAGCCACCACACUU*AUA 1
----------------GAUGACCACACAAGGCAGAUGGGCUAUGUAAACGUUUUCGCAAUUCCGUUUACGAUACAUAGUCUACUCUUGCGUAGAAUGAGUUCUCGUAGCUAAACAGCACAAGUAGGUUUAGUUAACUUUAAUCUCACAUAGCAAUCUUUAAUCAAUGUGUAACAUUAGGGAGGACUUGAAAGAGCCACCACAUUU*AUA 1
------------------UGACCACACAAGGCAGAUGGGCUAUGUAAACGUUUUCGCUAUUCCGUUUACGAUACAUAGUCUACUCUUGUGCAGAAUGAAUUCUCGUAGCUAAACAGCACAAGUAGGUUUAGUUAACUUUAAUCUCACAUAGCAAUCUUUAAUCAAUGUGUAACAUUAGGGAGGACUGGAAAGAGCCACCACAUAG*CUA 1
-------------------GACCACACAAGGCAGAUGGGCUAUAUAAACGUUUUCGCUUUUCCGUUUACGAUAUAUAGUCUACUCUUGUGCAGAAUGAAUUCUCGUAACUACAUAGCACAAGUAGAUGUAGUUAACUUUAAUCUCACAUAGCAAUCUUUAAUCAGUGUGUAACAUUAGGGAGGACUUGAAAGAGCCACCACAUUU*ACA 1
--------------------ACCACACAAGGCAGAUGGGCUAUGUAAACGUUUUCGCAAUUCCGUUUACGAUACAUAGUCUACUCUUGUGCAGAAUGAAUUCUCGUAGCUAAACAGCACAAGUAGGUUUAGUUAACUUUAAUCUCACAUAGCAAUCUUUAAUCAAUGUGUAACAUUAGGGAGGACUUGAAAGAGCCACCACAUUU*AUA 1
Click on headings to reorder table
| # | Matching motif group | Acceptance Rate | Mean Cutoff Score | Full Edit Distance | Interior Edit Distance | Basepair Diagram and most common annotation |
|---|---|---|---|---|---|---|
| 1 |
Motif group IL_99692.2
Basepair signature:
|
0.00 | -9999.00 | 188 | 188 |
Kink-turn |
| 2 |
Motif group IL_99646.2
Basepair signature:
|
0.00 | -9999.00 | 192 | 192 |
tSH-tHW |
| 3 |
Motif group IL_99498.1
Basepair signature:
|
0.00 | -9999.00 | 192 | 192 |
|
| 4 |
Motif group IL_99358.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 190 |
|
| 5 |
Motif group IL_99380.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
|
| 6 |
Motif group IL_98347.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
|
| 7 |
Motif group IL_97697.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 188 |
Reverse turn |
| 8 |
Motif group IL_97273.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 188 |
|
| 9 |
Motif group IL_97631.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 191 |
Triple sheared related |
| 10 |
Motif group IL_96788.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
|
| 11 |
Motif group IL_96759.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
|
| 12 |
Motif group IL_96371.1
Basepair signature:
|
0.00 | -9999.00 | 194 | 193 |
|
| 13 |
Motif group IL_96303.1
Basepair signature:
|
0.00 | -9999.00 | 182 | 181 |
|
| 14 |
Motif group IL_96332.5
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
|
| 15 |
Motif group IL_96236.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
|
| 16 |
Motif group IL_95811.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 187 |
Vitamin B12 Aptamer |
| 17 |
Motif group IL_95727.1
Basepair signature:
|
0.00 | -9999.00 | 187 | 188 |
Kink-turn |
| 18 |
Motif group IL_95570.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 189 |
|
| 19 |
Motif group IL_95583.2
Basepair signature:
|
0.00 | -9999.00 | 191 | 190 |
Minor groove platform, major groove intercalation |
| 20 |
Motif group IL_94967.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 190 |
|
| 21 |
Motif group IL_94910.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 188 |
Kink-turn |
| 22 |
Motif group IL_94684.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 188 |
|
| 23 |
Motif group IL_94351.1
Basepair signature:
|
0.00 | -9999.00 | 192 | 191 |
|
| 24 |
Motif group IL_93889.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 190 |
|
| 25 |
Motif group IL_92634.2
Basepair signature:
|
0.00 | -9999.00 | 188 | 189 |
|
| 26 |
Motif group IL_92446.2
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
|
| 27 |
Motif group IL_91920.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 28 |
Motif group IL_91636.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 188 |
|
| 29 |
Motif group IL_91698.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 191 |
|
| 30 |
Motif group IL_91592.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 188 |
|
| 31 |
Motif group IL_90729.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 191 |
Single stack bend |
| 32 |
Motif group IL_90351.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 33 |
Motif group IL_89984.3
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
|
| 34 |
Motif group IL_90346.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 35 |
Motif group IL_89505.4
Basepair signature:
|
0.00 | -9999.00 | 191 | 192 |
Single bulged U |
| 36 |
Motif group IL_89312.1
Basepair signature:
|
0.00 | -9999.00 | 187 | 187 |
|
| 37 |
Motif group IL_89099.1
Basepair signature:
|
0.00 | -9999.00 | 192 | 192 |
Other IL |
| 38 |
Motif group IL_89021.2
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
UAA/GAN |
| 39 |
Motif group IL_89047.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 188 |
|
| 40 |
Motif group IL_88974.1
Basepair signature:
|
0.00 | -9999.00 | 185 | 185 |
|
| 41 |
Motif group IL_88116.2
Basepair signature:
|
0.00 | -9999.00 | 191 | 192 |
|
| 42 |
Motif group IL_88269.4
Basepair signature:
|
0.00 | -9999.00 | 189 | 190 |
6x5 Sarcin-Ricin; G-bulge |
| 43 |
Motif group IL_88082.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 188 |
|
| 44 |
Motif group IL_88072.1
Basepair signature:
|
0.00 | -9999.00 | 186 | 185 |
|
| 45 |
Motif group IL_88017.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 188 |
|
| 46 |
Motif group IL_87907.2
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
Isolated non-canonical cWW pair |
| 47 |
Motif group IL_87290.1
Basepair signature:
|
0.00 | -9999.00 | 182 | 182 |
Kink-turn related |
| 48 |
Motif group IL_87284.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 192 |
tSH-tHW-tWH-tHS |
| 49 |
Motif group IL_87211.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
|
| 50 |
Motif group IL_86136.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 187 |
|
| 51 |
Motif group IL_86012.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
|
| 52 |
Motif group IL_85879.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 189 |
|
| 53 |
Motif group IL_85652.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 190 |
|
| 54 |
Motif group IL_85630.1
Basepair signature:
|
0.00 | -9999.00 | 187 | 188 |
|
| 55 |
Motif group IL_85599.2
Basepair signature:
|
0.00 | -9999.00 | 192 | 192 |
Isolated tHS basepair with bulges |
| 56 |
Motif group IL_85536.2
Basepair signature:
|
0.00 | -9999.00 | 190 | 191 |
|
| 57 |
Motif group IL_85498.1
Basepair signature:
|
0.00 | -9999.00 | 186 | 185 |
|
| 58 |
Motif group IL_85222.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 189 |
|
| 59 |
Motif group IL_85033.2
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
Tandem non-canonical cWW pairs |
| 60 |
Motif group IL_84694.2
Basepair signature:
|
0.00 | -9999.00 | 191 | 192 |
tSH-tHW-tHH-tHS |
| 61 |
Motif group IL_84665.1
Basepair signature:
|
0.00 | -9999.00 | 184 | 183 |
|
| 62 |
Motif group IL_84476.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 190 |
Multiple bulged bases |
| 63 |
Motif group IL_84251.1
Basepair signature:
|
0.00 | -9999.00 | 193 | 192 |
|
| 64 |
Motif group IL_84409.1
Basepair signature:
|
0.00 | -9999.00 | 187 | 188 |
|
| 65 |
Motif group IL_83389.2
Basepair signature:
|
0.00 | -9999.00 | 192 | 192 |
|
| 66 |
Motif group IL_83150.2
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 67 |
Motif group IL_83149.1
Basepair signature:
|
0.00 | -9999.00 | 187 | 188 |
|
| 68 |
Motif group IL_82741.2
Basepair signature:
|
0.00 | -9999.00 | 190 | 189 |
|
| 69 |
Motif group IL_82968.1
Basepair signature:
|
0.00 | -9999.00 | 187 | 186 |
|
| 70 |
Motif group IL_82706.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 188 |
|
| 71 |
Motif group IL_82426.6
Basepair signature:
|
0.00 | -9999.00 | 187 | 186 |
|
| 72 |
Motif group IL_82683.2
Basepair signature:
|
0.00 | -9999.00 | 189 | 190 |
|
| 73 |
Motif group IL_82292.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 191 |
|
| 74 |
Motif group IL_82107.4
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
Multiple bulged bases |
| 75 |
Motif group IL_81831.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
Intercalated cWS |
| 76 |
Motif group IL_81731.1
Basepair signature:
|
0.00 | -9999.00 | 184 | 185 |
|
| 77 |
Motif group IL_81522.2
Basepair signature:
|
0.00 | -9999.00 | 191 | 190 |
Major groove minor groove platform with intercalation; mini C-loop |
| 78 |
Motif group IL_81516.2
Basepair signature:
|
0.00 | -9999.00 | 182 | 182 |
|
| 79 |
Motif group IL_81392.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
|
| 80 |
Motif group IL_80926.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
|
| 81 |
Motif group IL_80412.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 188 |
|
| 82 |
Motif group IL_80604.6
Basepair signature:
|
0.00 | -9999.00 | 191 | 192 |
|
| 83 |
Motif group IL_80398.1
Basepair signature:
|
0.00 | -9999.00 | 192 | 192 |
Minor groove platform |
| 84 |
Motif group IL_80231.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
Other IL |
| 85 |
Motif group IL_80298.1
Basepair signature:
|
0.00 | -9999.00 | 172 | 173 |
|
| 86 |
Motif group IL_80209.1
Basepair signature:
|
0.00 | -9999.00 | 184 | 184 |
|
| 87 |
Motif group IL_79895.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
|
| 88 |
Motif group IL_79846.1
Basepair signature:
|
0.00 | -9999.00 | 179 | 179 |
|
| 89 |
Motif group IL_78800.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 191 |
|
| 90 |
Motif group IL_78472.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 189 |
|
| 91 |
Motif group IL_78349.3
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
|
| 92 |
Motif group IL_77870.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 188 |
|
| 93 |
Motif group IL_77691.5
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
UAA/GAN related |
| 94 |
Motif group IL_77658.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
Tandem non-canonical cWW pairs |
| 95 |
Motif group IL_77045.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 189 |
Kink-turn |
| 96 |
Motif group IL_77278.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
|
| 97 |
Motif group IL_76758.2
Basepair signature:
|
0.00 | -9999.00 | 190 | 189 |
Intercalated tWH |
| 98 |
Motif group IL_76460.1
Basepair signature:
|
0.00 | -9999.00 | 180 | 179 |
|
| 99 |
Motif group IL_76709.2
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
|
| 100 |
Motif group IL_76319.5
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
|
| 101 |
Motif group IL_76308.6
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
tSH-tWH-tHS-cWW |
| 102 |
Motif group IL_75294.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 103 |
Motif group IL_74957.1
Basepair signature:
|
0.00 | -9999.00 | 186 | 186 |
cWH basepair with bulged bases |
| 104 |
Motif group IL_75283.2
Basepair signature:
|
0.00 | -9999.00 | 182 | 182 |
|
| 105 |
Motif group IL_74746.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 106 |
Motif group IL_74184.1
Basepair signature:
|
0.00 | -9999.00 | 187 | 186 |
|
| 107 |
Motif group IL_74367.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 191 |
|
| 108 |
Motif group IL_74051.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 188 |
Kink-turn |
| 109 |
Motif group IL_73789.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 189 |
|
| 110 |
Motif group IL_73759.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 190 |
Part of G-quadruplex |
| 111 |
Motif group IL_73452.2
Basepair signature:
|
0.00 | -9999.00 | 191 | 190 |
|
| 112 |
Motif group IL_73700.1
Basepair signature:
|
0.00 | -9999.00 | 187 | 188 |
|
| 113 |
Motif group IL_73002.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 187 |
|
| 114 |
Motif group IL_73355.1
Basepair signature:
|
0.00 | -9999.00 | 192 | 191 |
|
| 115 |
Motif group IL_71598.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
|
| 116 |
Motif group IL_71294.3
Basepair signature:
|
0.00 | -9999.00 | 191 | 192 |
Double sheared; A in syn; two near cWW pairs |
| 117 |
Motif group IL_70923.9
Basepair signature:
|
0.00 | -9999.00 | 188 | 189 |
Kink-turn |
| 118 |
Motif group IL_70801.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
|
| 119 |
Motif group IL_70670.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 192 |
9x9 Sarcin-Ricin with pseudoknotted region; G-bulge |
| 120 |
Motif group IL_70411.2
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 121 |
Motif group IL_70627.3
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
UAA/GAN related |
| 122 |
Motif group IL_70376.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
|
| 123 |
Motif group IL_70335.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 191 |
|
| 124 |
Motif group IL_69986.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 191 |
|
| 125 |
Motif group IL_70096.1
Basepair signature:
|
0.00 | -9999.00 | 193 | 193 |
Kink-turn related |
| 126 |
Motif group IL_69543.3
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
|
| 127 |
Motif group IL_69440.3
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 128 |
Motif group IL_69271.3
Basepair signature:
|
0.00 | -9999.00 | 184 | 184 |
|
| 129 |
Motif group IL_69229.3
Basepair signature:
|
0.00 | -9999.00 | 188 | 188 |
Kink-turn |
| 130 |
Motif group IL_69000.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 189 |
|
| 131 |
Motif group IL_69145.3
Basepair signature:
|
0.00 | -9999.00 | 189 | 190 |
Pseudoknot |
| 132 |
Motif group IL_68909.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 133 |
Motif group IL_68574.4
Basepair signature:
|
0.00 | -9999.00 | 192 | 192 |
|
| 134 |
Motif group IL_68243.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
|
| 135 |
Motif group IL_68405.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
Kink-turn related |
| 136 |
Motif group IL_68140.4
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
Major groove minor groove platform; mini C-loop |
| 137 |
Motif group IL_67767.4
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
Receptor of 11-nt loop-receptor motif |
| 138 |
Motif group IL_67780.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 192 |
|
| 139 |
Motif group IL_67623.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 189 |
Minor groove platform related |
| 140 |
Motif group IL_67095.2
Basepair signature:
|
0.00 | -9999.00 | 192 | 192 |
Isolated tWW turn |
| 141 |
Motif group IL_66997.2
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 142 |
Motif group IL_66798.2
Basepair signature:
|
0.00 | -9999.00 | 191 | 192 |
AAA cross-strand stack |
| 143 |
Motif group IL_66635.5
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
Major groove intercalation |
| 144 |
Motif group IL_66663.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
|
| 145 |
Motif group IL_65851.3
Basepair signature:
|
0.00 | -9999.00 | 191 | 192 |
|
| 146 |
Motif group IL_65718.4
Basepair signature:
|
0.00 | -9999.00 | 192 | 191 |
|
| 147 |
Motif group IL_65594.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
8x7 Sarcin-Ricin; G-bulge |
| 148 |
Motif group IL_65653.1
Basepair signature:
|
0.00 | -9999.00 | 185 | 186 |
|
| 149 |
Motif group IL_64900.1
Basepair signature:
|
0.00 | -9999.00 | 187 | 188 |
Kink-turn |
| 150 |
Motif group IL_64858.3
Basepair signature:
|
0.00 | -9999.00 | 188 | 188 |
|
| 151 |
Motif group IL_64842.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 187 |
|
| 152 |
Motif group IL_64403.1
Basepair signature:
|
0.00 | -9999.00 | 185 | 186 |
|
| 153 |
Motif group IL_64231.5
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 154 |
Motif group IL_64048.1
Basepair signature:
|
0.00 | -9999.00 | 185 | 185 |
|
| 155 |
Motif group IL_63775.1
Basepair signature:
|
0.00 | -9999.00 | 193 | 192 |
|
| 156 |
Motif group IL_63596.11
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
C-loop |
| 157 |
Motif group IL_63519.1
Basepair signature:
|
0.00 | -9999.00 | 192 | 192 |
|
| 158 |
Motif group IL_62654.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 192 |
tSH-tHH-tHS |
| 159 |
Motif group IL_62012.1
Basepair signature:
|
0.00 | -9999.00 | 192 | 191 |
Decoding loop related |
| 160 |
Motif group IL_61476.2
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 161 |
Motif group IL_61438.4
Basepair signature:
|
0.00 | -9999.00 | 192 | 191 |
|
| 162 |
Motif group IL_61440.1
Basepair signature:
|
0.00 | -9999.00 | 192 | 192 |
Triple sheared |
| 163 |
Motif group IL_61341.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 190 |
|
| 164 |
Motif group IL_61299.4
Basepair signature:
|
0.00 | -9999.00 | 189 | 188 |
|
| 165 |
Motif group IL_61286.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
8x6 Sarcin-Ricin with inserted A; G-bulge |
| 166 |
Motif group IL_61258.15
Basepair signature:
|
0.00 | -9999.00 | 191 | 192 |
Single bulged C |
| 167 |
Motif group IL_61249.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 191 |
|
| 168 |
Motif group IL_61242.1
Basepair signature:
|
0.00 | -9999.00 | 192 | 191 |
|
| 169 |
Motif group IL_60657.1
Basepair signature:
|
0.00 | -9999.00 | 184 | 183 |
|
| 170 |
Motif group IL_60797.1
Basepair signature:
|
0.00 | -9999.00 | 192 | 193 |
|
| 171 |
Motif group IL_60448.1
Basepair signature:
|
0.00 | -9999.00 | 186 | 186 |
|
| 172 |
Motif group IL_59724.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
8x7 Sarcin-Ricin with CC bifurcated pair; G-bulge |
| 173 |
Motif group IL_59877.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
|
| 174 |
Motif group IL_59302.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
|
| 175 |
Motif group IL_59258.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 176 |
Motif group IL_59049.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 190 |
|
| 177 |
Motif group IL_58960.1
Basepair signature:
|
0.00 | -9999.00 | 186 | 186 |
|
| 178 |
Motif group IL_58126.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 189 |
|
| 179 |
Motif group IL_58350.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 180 |
Motif group IL_58112.2
Basepair signature:
|
0.00 | -9999.00 | 191 | 192 |
|
| 181 |
Motif group IL_57881.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 190 |
Multiple bulged bases |
| 182 |
Motif group IL_58103.11
Basepair signature:
|
0.00 | -9999.00 | 190 | 191 |
Symmetric double minor groove platform |
| 183 |
Motif group IL_57744.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
Isolated non-canonical cWW pair |
| 184 |
Motif group IL_57741.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 188 |
|
| 185 |
Motif group IL_56987.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
|
| 186 |
Motif group IL_57188.5
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
Kink-turn related |
| 187 |
Motif group IL_56455.6
Basepair signature:
|
0.00 | -9999.00 | 190 | 191 |
Bacterial 5S Loop E |
| 188 |
Motif group IL_56317.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 190 |
|
| 189 |
Motif group IL_55953.3
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
|
| 190 |
Motif group IL_55917.1
Basepair signature:
|
0.00 | -9999.00 | 186 | 186 |
|
| 191 |
Motif group IL_55516.2
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
|
| 192 |
Motif group IL_54737.1
Basepair signature:
|
0.00 | -9999.00 | 182 | 182 |
|
| 193 |
Motif group IL_54896.1
Basepair signature:
|
0.00 | -9999.00 | 186 | 185 |
|
| 194 |
Motif group IL_54177.4
Basepair signature:
|
0.00 | -9999.00 | 192 | 193 |
|
| 195 |
Motif group IL_54050.1
Basepair signature:
|
0.00 | -9999.00 | 185 | 185 |
|
| 196 |
Motif group IL_54041.2
Basepair signature:
|
0.00 | -9999.00 | 188 | 188 |
tHW-tHW cross-strand stack |
| 197 |
Motif group IL_53596.1
Basepair signature:
|
0.00 | -9999.00 | 186 | 186 |
|
| 198 |
Motif group IL_53787.1
Basepair signature:
|
0.00 | -9999.00 | 182 | 182 |
Pseudoknot |
| 199 |
Motif group IL_53581.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 189 |
Kink-turn related |
| 200 |
Motif group IL_53448.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
Receptor of 11-nt loop-receptor motif |
| 201 |
Motif group IL_52743.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 188 |
|
| 202 |
Motif group IL_51454.3
Basepair signature:
|
0.00 | -9999.00 | 190 | 191 |
Minor groove platform |
| 203 |
Motif group IL_51479.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
|
| 204 |
Motif group IL_51387.2
Basepair signature:
|
0.00 | -9999.00 | 188 | 189 |
|
| 205 |
Motif group IL_51265.3
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
Kink-turn from U4 |
| 206 |
Motif group IL_51191.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 188 |
|
| 207 |
Motif group IL_50715.3
Basepair signature:
|
0.00 | -9999.00 | 181 | 182 |
|
| 208 |
Motif group IL_50730.2
Basepair signature:
|
0.00 | -9999.00 | 191 | 192 |
Triple sheared |
| 209 |
Motif group IL_50694.7
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
Major groove platform; stack outside cWW |
| 210 |
Motif group IL_49971.1
Basepair signature:
|
0.00 | -9999.00 | 187 | 186 |
|
| 211 |
Motif group IL_49867.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 190 |
|
| 212 |
Motif group IL_49767.8
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
UAA/GAN with extra cWW |
| 213 |
Motif group IL_49751.4
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
Triple non-canonical cWW pairs |
| 214 |
Motif group IL_49714.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 188 |
Major groove intercalation |
| 215 |
Motif group IL_49061.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 188 |
|
| 216 |
Motif group IL_49612.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 188 |
|
| 217 |
Motif group IL_48444.6
Basepair signature:
|
0.00 | -9999.00 | 191 | 192 |
|
| 218 |
Motif group IL_48076.6
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
Major groove platform |
| 219 |
Motif group IL_47972.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 190 |
|
| 220 |
Motif group IL_47108.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
|
| 221 |
Motif group IL_47346.2
Basepair signature:
|
0.00 | -9999.00 | 191 | 192 |
tSH-tSH-tHH-tHS |
| 222 |
Motif group IL_47087.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 187 |
Kink-turn related |
| 223 |
Motif group IL_47078.3
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
Minor groove platform |
| 224 |
Motif group IL_47074.2
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
|
| 225 |
Motif group IL_46387.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
|
| 226 |
Motif group IL_46174.3
Basepair signature:
|
0.00 | -9999.00 | 188 | 189 |
Kink-turn with non-sequential stacking |
| 227 |
Motif group IL_46086.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 188 |
|
| 228 |
Motif group IL_46112.1
Basepair signature:
|
0.00 | -9999.00 | 186 | 186 |
|
| 229 |
Motif group IL_45896.1
Basepair signature:
|
0.00 | -9999.00 | 193 | 193 |
|
| 230 |
Motif group IL_45444.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 231 |
Motif group IL_44874.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 188 |
tSH-tHW |
| 232 |
Motif group IL_44465.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
Isolated non-canonical cWW contact |
| 233 |
Motif group IL_44624.1
Basepair signature:
|
0.00 | -9999.00 | 185 | 184 |
|
| 234 |
Motif group IL_44438.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 191 |
|
| 235 |
Motif group IL_44325.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 190 |
|
| 236 |
Motif group IL_43858.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 190 |
|
| 237 |
Motif group IL_43644.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
Other IL |
| 238 |
Motif group IL_43547.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 190 |
10x8 Sarcin-Ricin; G-bulge |
| 239 |
Motif group IL_43622.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 188 |
|
| 240 |
Motif group IL_43467.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 189 |
Pseudoknot |
| 241 |
Motif group IL_43140.1
Basepair signature:
|
0.00 | -9999.00 | 186 | 185 |
|
| 242 |
Motif group IL_42997.3
Basepair signature:
|
0.00 | -9999.00 | 190 | 191 |
Isolated cWS basepair |
| 243 |
Motif group IL_42771.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
Multiple bulged bases |
| 244 |
Motif group IL_42778.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 192 |
|
| 245 |
Motif group IL_42626.2
Basepair signature:
|
0.00 | -9999.00 | 192 | 193 |
|
| 246 |
Motif group IL_42314.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 247 |
Motif group IL_42231.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 188 |
|
| 248 |
Motif group IL_42032.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 188 |
|
| 249 |
Motif group IL_42218.2
Basepair signature:
|
0.00 | -9999.00 | 184 | 183 |
|
| 250 |
Motif group IL_41853.1
Basepair signature:
|
0.00 | -9999.00 | 187 | 187 |
|
| 251 |
Motif group IL_41756.4
Basepair signature:
|
0.00 | -9999.00 | 189 | 190 |
8x6 Sarcin-Ricin with inserted Y; G-bulge |
| 252 |
Motif group IL_41344.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
|
| 253 |
Motif group IL_41203.4
Basepair signature:
|
0.00 | -9999.00 | 186 | 187 |
SSU/LSU pseudoknot |
| 254 |
Motif group IL_38969.1
Basepair signature:
|
0.00 | -9999.00 | 187 | 186 |
Reverse kink-turn related |
| 255 |
Motif group IL_38862.4
Basepair signature:
|
0.00 | -9999.00 | 191 | 192 |
5x5 Sarcin-Ricin with intercalated A; G-bulge |
| 256 |
Motif group IL_38634.5
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
cWH basepair and non-canonical AC |
| 257 |
Motif group IL_38394.1
Basepair signature:
|
0.00 | -9999.00 | 187 | 187 |
|
| 258 |
Motif group IL_38507.2
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
UAA/GAN |
| 259 |
Motif group IL_38186.6
Basepair signature:
|
0.00 | -9999.00 | 188 | 188 |
|
| 260 |
Motif group IL_37752.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 188 |
|
| 261 |
Motif group IL_37603.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 187 |
|
| 262 |
Motif group IL_37015.1
Basepair signature:
|
0.00 | -9999.00 | 187 | 187 |
Kink-turn |
| 263 |
Motif group IL_36729.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 264 |
Motif group IL_34822.1
Basepair signature:
|
0.00 | -9999.00 | 192 | 192 |
|
| 265 |
Motif group IL_36516.3
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 266 |
Motif group IL_34739.3
Basepair signature:
|
0.00 | -9999.00 | 175 | 175 |
|
| 267 |
Motif group IL_34737.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 268 |
Motif group IL_34470.3
Basepair signature:
|
0.00 | -9999.00 | 190 | 191 |
9x8 Sarcin-Ricin with GA cWW pair; G-bulge |
| 269 |
Motif group IL_33761.2
Basepair signature:
|
0.00 | -9999.00 | 192 | 191 |
|
| 270 |
Motif group IL_33886.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 189 |
Kink-turn with embedded cWW pair |
| 271 |
Motif group IL_33711.1
Basepair signature:
|
0.00 | -9999.00 | 186 | 186 |
Minor groove platform |
| 272 |
Motif group IL_33623.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 187 |
|
| 273 |
Motif group IL_33323.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 189 |
|
| 274 |
Motif group IL_33141.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
|
| 275 |
Motif group IL_32056.1
Basepair signature:
|
0.00 | -9999.00 | 185 | 184 |
|
| 276 |
Motif group IL_31915.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 189 |
|
| 277 |
Motif group IL_32016.1
Basepair signature:
|
0.00 | -9999.00 | 192 | 193 |
Kink-turn |
| 278 |
Motif group IL_31737.3
Basepair signature:
|
0.00 | -9999.00 | 192 | 191 |
Stack and bulge |
| 279 |
Motif group IL_31561.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 191 |
|
| 280 |
Motif group IL_31558.1
Basepair signature:
|
0.00 | -9999.00 | 192 | 191 |
|
| 281 |
Motif group IL_31531.3
Basepair signature:
|
0.00 | -9999.00 | 192 | 191 |
Decoding loop related |
| 282 |
Motif group IL_31462.6
Basepair signature:
|
0.00 | -9999.00 | 191 | 192 |
Single bulged A |
| 283 |
Motif group IL_31504.1
Basepair signature:
|
0.00 | -9999.00 | 181 | 181 |
|
| 284 |
Motif group IL_31084.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 190 |
|
| 285 |
Motif group IL_30730.1
Basepair signature:
|
0.00 | -9999.00 | 185 | 185 |
|
| 286 |
Motif group IL_30441.1
Basepair signature:
|
0.00 | -9999.00 | 182 | 181 |
|
| 287 |
Motif group IL_29471.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 189 |
|
| 288 |
Motif group IL_29826.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 189 |
|
| 289 |
Motif group IL_29357.1
Basepair signature:
|
0.00 | -9999.00 | 187 | 188 |
|
| 290 |
Motif group IL_29346.2
Basepair signature:
|
0.00 | -9999.00 | 190 | 189 |
Left turn |
| 291 |
Motif group IL_29223.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 190 |
|
| 292 |
Motif group IL_29198.2
Basepair signature:
|
0.00 | -9999.00 | 190 | 191 |
7x7 Sarcin-Ricin with intercalated A; G-bulge |
| 293 |
Motif group IL_28564.1
Basepair signature:
|
0.00 | -9999.00 | 192 | 191 |
|
| 294 |
Motif group IL_28788.1
Basepair signature:
|
0.00 | -9999.00 | 194 | 194 |
|
| 295 |
Motif group IL_28304.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
|
| 296 |
Motif group IL_28037.2
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
Isolated non-canonical cWW pair |
| 297 |
Motif group IL_28026.3
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 298 |
Motif group IL_27393.10
Basepair signature:
|
0.00 | -9999.00 | 188 | 187 |
|
| 299 |
Motif group IL_26793.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 192 |
Single stack bend |
| 300 |
Motif group IL_26728.3
Basepair signature:
|
0.00 | -9999.00 | 191 | 190 |
|
| 301 |
Motif group IL_26685.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 190 |
Multiple bulged bases |
| 302 |
Motif group IL_26307.2
Basepair signature:
|
0.00 | -9999.00 | 190 | 191 |
7x6 Sarcin-Ricin; G-bulge |
| 303 |
Motif group IL_26598.1
Basepair signature:
|
0.00 | -9999.00 | 187 | 187 |
|
| 304 |
Motif group IL_26222.2
Basepair signature:
|
0.00 | -9999.00 | 189 | 190 |
C-loop with bulged stacked A's |
| 305 |
Motif group IL_25872.4
Basepair signature:
|
0.00 | -9999.00 | 192 | 192 |
|
| 306 |
Motif group IL_25573.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 189 |
|
| 307 |
Motif group IL_25463.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
|
| 308 |
Motif group IL_25412.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 188 |
Major groove intercalation |
| 309 |
Motif group IL_25186.4
Basepair signature:
|
0.00 | -9999.00 | 192 | 192 |
|
| 310 |
Motif group IL_24499.1
Basepair signature:
|
0.00 | -9999.00 | 187 | 187 |
|
| 311 |
Motif group IL_24254.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 190 |
7x6 Sarcin-Ricin with UU cWW pair; G-bulge |
| 312 |
Motif group IL_24134.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 188 |
Kink-turn |
| 313 |
Motif group IL_23774.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
UAA/GAN variation |
| 314 |
Motif group IL_23038.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 190 |
|
| 315 |
Motif group IL_22854.4
Basepair signature:
|
0.00 | -9999.00 | 188 | 187 |
|
| 316 |
Motif group IL_22829.2
Basepair signature:
|
0.00 | -9999.00 | 188 | 188 |
|
| 317 |
Motif group IL_22564.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
|
| 318 |
Motif group IL_22551.4
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 319 |
Motif group IL_22373.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 189 |
8-nt loop receptor |
| 320 |
Motif group IL_21667.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 191 |
|
| 321 |
Motif group IL_21630.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 322 |
Motif group IL_21200.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
tSH-tHW |
| 323 |
Motif group IL_21173.1
Basepair signature:
|
0.00 | -9999.00 | 187 | 186 |
|
| 324 |
Motif group IL_20463.1
Basepair signature:
|
0.00 | -9999.00 | 186 | 187 |
7x11 Sarcin-Ricin with pseudoknotted region; G-bulge |
| 325 |
Motif group IL_21001.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 191 |
|
| 326 |
Motif group IL_20245.1
Basepair signature:
|
0.00 | -9999.00 | 182 | 182 |
|
| 327 |
Motif group IL_20047.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
|
| 328 |
Motif group IL_20031.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 329 |
Motif group IL_19897.3
Basepair signature:
|
0.00 | -9999.00 | 186 | 186 |
|
| 330 |
Motif group IL_19668.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
Isolated non-canonical cWW pair |
| 331 |
Motif group IL_19852.1
Basepair signature:
|
0.00 | -9999.00 | 183 | 184 |
Part of G-quadruplex |
| 332 |
Motif group IL_19516.1
Basepair signature:
|
0.00 | -9999.00 | 183 | 183 |
Pseudoknot |
| 333 |
Motif group IL_19102.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 334 |
Motif group IL_19048.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 335 |
Motif group IL_18487.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 336 |
Motif group IL_18472.4
Basepair signature:
|
0.00 | -9999.00 | 190 | 191 |
|
| 337 |
Motif group IL_18354.1
Basepair signature:
|
0.00 | -9999.00 | 184 | 184 |
|
| 338 |
Motif group IL_17948.2
Basepair signature:
|
0.00 | -9999.00 | 191 | 192 |
Double sheared with non-canonical cWW |
| 339 |
Motif group IL_17973.1
Basepair signature:
|
0.00 | -9999.00 | 181 | 180 |
|
| 340 |
Motif group IL_17765.1
Basepair signature:
|
0.00 | -9999.00 | 185 | 184 |
|
| 341 |
Motif group IL_17069.5
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
Kink-turn related |
| 342 |
Motif group IL_17136.7
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
tSH-tWH-tHS |
| 343 |
Motif group IL_16665.1
Basepair signature:
|
0.00 | -9999.00 | 187 | 187 |
|
| 344 |
Motif group IL_16458.4
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
Sarcin-Ricin target in LSU H95; G-bulge |
| 345 |
Motif group IL_16386.4
Basepair signature:
|
0.00 | -9999.00 | 193 | 192 |
|
| 346 |
Motif group IL_16218.2
Basepair signature:
|
0.00 | -9999.00 | 192 | 191 |
|
| 347 |
Motif group IL_15991.1
Basepair signature:
|
0.00 | -9999.00 | 187 | 186 |
|
| 348 |
Motif group IL_15698.3
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
|
| 349 |
Motif group IL_15218.1
Basepair signature:
|
0.00 | -9999.00 | 185 | 184 |
|
| 350 |
Motif group IL_15107.1
Basepair signature:
|
0.00 | -9999.00 | 187 | 188 |
|
| 351 |
Motif group IL_15052.4
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
Minor groove platform |
| 352 |
Motif group IL_14688.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
Isolated non-canonical cWW pair |
| 353 |
Motif group IL_14177.2
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
|
| 354 |
Motif group IL_14368.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
Major groove platform with intercalated tWH |
| 355 |
Motif group IL_13874.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 189 |
|
| 356 |
Motif group IL_13394.1
Basepair signature:
|
0.00 | -9999.00 | 180 | 180 |
|
| 357 |
Motif group IL_13404.2
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
Tandem non-canonical cWW pairs |
| 358 |
Motif group IL_13358.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 188 |
|
| 359 |
Motif group IL_12745.1
Basepair signature:
|
0.00 | -9999.00 | 192 | 192 |
tWH-tWH-tHW-tHW |
| 360 |
Motif group IL_12566.4
Basepair signature:
|
0.00 | -9999.00 | 189 | 188 |
|
| 361 |
Motif group IL_12697.1
Basepair signature:
|
0.00 | -9999.00 | 192 | 193 |
|
| 362 |
Motif group IL_11415.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 363 |
Motif group IL_11399.2
Basepair signature:
|
0.00 | -9999.00 | 192 | 191 |
|
| 364 |
Motif group IL_11344.2
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
180 degree turn |
| 365 |
Motif group IL_10796.1
Basepair signature:
|
0.00 | -9999.00 | 193 | 192 |
|
| 366 |
Motif group IL_10569.1
Basepair signature:
|
0.00 | -9999.00 | 192 | 192 |
|
| 367 |
Motif group IL_10167.6
Basepair signature:
|
0.00 | -9999.00 | 192 | 191 |
Isolated cWH basepair |
| 368 |
Motif group IL_10484.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
Double sheared |
| 369 |
Motif group IL_10389.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 189 |
|
| 370 |
Motif group IL_09990.4
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
|
| 371 |
Motif group IL_09908.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
Reverse kink-turn |
| 372 |
Motif group IL_09705.15
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
Double sheared |
| 373 |
Motif group IL_09570.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 188 |
|
| 374 |
Motif group IL_09129.2
Basepair signature:
|
0.00 | -9999.00 | 190 | 191 |
|
| 375 |
Motif group IL_08770.1
Basepair signature:
|
0.00 | -9999.00 | 192 | 191 |
|
| 376 |
Motif group IL_09044.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 377 |
Motif group IL_07785.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 189 |
Isolated non-canonical cWW pair |
| 378 |
Motif group IL_07469.2
Basepair signature:
|
0.00 | -9999.00 | 188 | 189 |
|
| 379 |
Motif group IL_07171.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
Bulged stacked bases |
| 380 |
Motif group IL_07173.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 189 |
|
| 381 |
Motif group IL_07039.3
Basepair signature:
|
0.00 | -9999.00 | 192 | 192 |
Major groove platform |
| 382 |
Motif group IL_06549.2
Basepair signature:
|
0.00 | -9999.00 | 193 | 193 |
|
| 383 |
Motif group IL_06691.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 190 |
|
| 384 |
Motif group IL_06300.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 385 |
Motif group IL_06136.2
Basepair signature:
|
0.00 | -9999.00 | 191 | 191 |
Quadruple sheared |
| 386 |
Motif group IL_06029.1
Basepair signature:
|
0.00 | -9999.00 | 182 | 182 |
Kink-turn |
| 387 |
Motif group IL_05192.4
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 388 |
Motif group IL_05472.1
Basepair signature:
|
0.00 | -9999.00 | 188 | 187 |
|
| 389 |
Motif group IL_04785.1
Basepair signature:
|
0.00 | -9999.00 | 193 | 192 |
|
| 390 |
Motif group IL_04736.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 191 |
|
| 391 |
Motif group IL_04650.2
Basepair signature:
|
0.00 | -9999.00 | 185 | 185 |
|
| 392 |
Motif group IL_04638.3
Basepair signature:
|
0.00 | -9999.00 | 187 | 187 |
tSH-tHS-tHW |
| 393 |
Motif group IL_04600.1
Basepair signature:
|
0.00 | -9999.00 | 191 | 192 |
|
| 394 |
Motif group IL_04346.10
Basepair signature:
|
0.00 | -9999.00 | 189 | 190 |
8x7 Sarcin-Ricin; G-bulge |
| 395 |
Motif group IL_04332.3
Basepair signature:
|
0.00 | -9999.00 | 184 | 183 |
|
| 396 |
Motif group IL_04307.1
Basepair signature:
|
0.00 | -9999.00 | 187 | 187 |
|
| 397 |
Motif group IL_04073.1
Basepair signature:
|
0.00 | -9999.00 | 189 | 189 |
|
| 398 |
Motif group IL_04021.2
Basepair signature:
|
0.00 | -9999.00 | 190 | 191 |
Triple sheared with non-canonical cWW |
| 399 |
Motif group IL_03350.1
Basepair signature:
|
0.00 | -9999.00 | 187 | 187 |
Reverse kink-turn related |
| 400 |
Motif group IL_03109.3
Basepair signature:
|
0.00 | -9999.00 | 189 | 190 |
C-loop |
| 401 |
Motif group IL_02555.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 191 |
Major groove platform with intercalation |
| 402 |
Motif group IL_02349.4
Basepair signature:
|
0.00 | -9999.00 | 189 | 190 |
8x6 Sarcin-Ricin with bulged A; G-bulge |
| 403 |
Motif group IL_02203.1
Basepair signature:
|
0.00 | -9999.00 | 192 | 191 |
|
| 404 |
Motif group IL_01488.3
Basepair signature:
|
0.00 | -9999.00 | 188 | 188 |
Kink-turn |
| 405 |
Motif group IL_01994.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 189 |
|
| 406 |
Motif group IL_01176.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 191 |
|
| 407 |
Motif group IL_01038.1
Basepair signature:
|
0.00 | -9999.00 | 192 | 193 |
UAA/GAN with extra stack |
| 408 |
Motif group IL_00981.1
Basepair signature:
|
0.00 | -9999.00 | 192 | 193 |
UAA/GAN with tHH |
| 409 |
Motif group IL_00881.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 190 |
|
| 410 |
Motif group IL_00555.1
Basepair signature:
|
0.00 | -9999.00 | 190 | 189 |
|
| 411 |
Motif group IL_00225.13
Basepair signature:
|
0.00 | -9999.00 | 191 | 192 |
Single bulged G |